It is critical that any discourse start simple and then build to the complex.

Since we'll be talking about living things we'll need to establish some axioms of Biology.

Are you firmly aware of DNA, and how it genotype relates to phenotype?

That is, the genetic instructions of an organism largely contribute to its final body organization as it grows and develops.

Let's start with this. No name-calling. No other topics. This is about Biology first. Do you understand these topics GoodScienceForYou?

wrote on Nov 17^th, 2009 at 2:21pm:

It is critical that any discourse start simple and then build to the complex. Since we'll be talking about living things we'll need to establish some axioms of Biology. Are you firmly aware of DNA, and how it genotype relates to phenotype? That is, the genetic instructions of an organism largely contribute to its final body organization as it grows and develops. Let's start with this. No name-calling. No other topics. This is about Biology first. Do you understand these topics GoodScienceForYou?

I highlighted the part that I find silly.  What we need to establish is foundations for the belief in Evolution.  And to not use axioms until these foundations are established and proven.  Opinions are not science. And in indoctrination methods "axioms" become slogans that have no actual evidence to back them.  If you repeat the same "axioms" from a position of "authority" without having real evidence, then it becomes obvious standard brainwashing techniques.
We don't need no stinking "slogans" only foundational factual and absolute evidence to form any conclusions.

Thanks for coming over!  The rules here that I enforce is no name calling nothing illegal, like defamation or copyright infringement and such: just keep on topic. If you attack me I will put you in your place and you can leave. If you post nonsense, I will attack your nonsense and you will probably leave as most people with no courage do.


This has nothing to do with the subject of evolution, unless you can tie this to some form of evidence.
I know how DNA works according to what scientists know, and I know what they don't know about DNA. And I know what they assume about DNA.

When Evodelusionist, regularly use what they don't know, and make assumptions to explain it, this is not any form of science that I was ever taught.

How does this tie in with any creature that has ever been proven to break the boundary of genetics and become some new creature over any length of time?
How does this prove that  fish (marine life) have become reptiles, and reptiles have become mammals and birds and by some magical process eventually become all the life you see?

With no implications or opinions? That is my question.
This is the final premise of evolution that most seem to avoid and change the definition to match the belief.
I have been studying this for over 40 years wanting for some real evidence.  What do you have?

My questions are always simple and straightforward.
Genotype is the instructions built into the genome and the phenotype is the outward manifestation of the genetic instructions contained in the genetic codings and  DNA ( and more).

The aim of this thread was to start simple and build a set of shared axioms. My interest is to build and build until we reach a point of contention, then we can discuss it.

So why did you ignore this aim? What you're doing is the equivalent of shouting over someone in a conversation. You ignored the fundamental aim of the thread.

Now...
This has nothing to do with the subject of evolution
If you truly believe this then we don't have anything more to talk about.

Do you agree that the expression of genes, coded in DNA, play a large role in the development and shape of a living thing?

wrote on Nov 17^th, 2009 at 4:38pm:

The aim of this thread was to start simple and build a set of shared axioms. My interest is to build and build until we reach a point of contention, then we can discuss it. So why did you ignore this aim? What you're doing is the equivalent of shouting over someone in a conversation. You ignored the fundamental aim of the thread. Now... This has nothing to do with the subject of evolution If you truly believe this then we don't have anything more to talk about. Do you agree that the expression of genes, coded in DNA, play a large role in the development and shape of a living thing?

You are the one who needs to show if there is any relationship between DNA and the development of living from the DNA and this idea of creatures changing their DNA over some immense time into entirely new creatures.  That IS the question.
Since I have looked at how DNA works and all of the physical evidence there is on this subject, I have not been able to conclude evolution from what we actually know, empirically and what is in real evidence.

If you can show this I will welcome it.  If you can't then you can't.  Are you willing to see where this discussion goes?
There is no need to be afraid.

"Do you agree that the expression of genes, coded in DNA, play a large role in the development and shape of a living thing?"
Anyone who has studied this DNA would know that what is "programmed" in the genetic coding of the DNA is what is manifest in the cells of the organic creature.

What does this have to do with theory of evolution?

creatures changing their DNA over some immense time into entirely new creatures.  That IS the question.

Once again you're skipping far far ahead. How can we discuss such things without a collection of mutually shared axioms. It's like discussing mathematics and you have different symbols for all of the operations and you're using a base 15 number system.

We can't get anywhere like this. You're really pushing the edge of my patience. Now do you want to work on building a set of axioms or are we done here?

Go on with your presentation. You can post all the videos you want as well to discuss.  IF you want youtubes, you select the URL of the video and paste it. Then select it in the window and press "media" the 5th from the top left.

Mutation is a loaded word. But are you aware that DNA changes for various reasons. And that the DNA an organism inherits from it's parent(s) may be slightly different than the version in the parent?

;D ;D

wrote on Nov 17^th, 2009 at 4:59pm:

creatures changing their DNA over some immense time into entirely new creatures.  That IS the question. Once again you're skipping far far ahead. How can we discuss such things without a collection of mutually shared axioms. It's like discussing mathematics and you have different symbols for all of the operations and you're using a base 15 number system. We can't get anywhere like this. You're really pushing the edge of my patience. Now do you want to work on building a set of axioms or are we done here?

My axiom;  "The truth is far more important that anyone  or any person's beliefs.  If you don't have an open discussion with people who differ from you, you will never find the truth."

In order to have a discussion you need to listen.  I listen to all of your nonsense that leads no where.  Why don't you listen to the voice of reason and logic and a hell of a lot of study on this?

There is no sound from one hand clapping.
;D ;D

;D ;D
wrote on Nov 17^th, 2009 at 5:44pm:

Mutation is a loaded word. But are you aware that DNA changes for various reasons. And that the DNA an organism inherits from it's parent(s) may be slightly different than the version in the parent?

Since you know it is a loaded word, I will explain it to the readers:

What you call mutations is really just variations or differences shown in the DNA (genetics) from the parents and some later adaptations to the environment as seen in the offspring, and are not by definition really mutations*, because the geneticists don't really know what they are or how they manifested from what actual precise cause.  The science of DNA is not that advanced.

These are differences to the genome, but the science of genetics really doesn't have full understanding.  There is a mistaken premise of the general public that scientists actually have a handle on the natural world, but they can barely blow their noses, relatively speaking, considering how much science does not know, and how bad science has become from a form of seeking truth, to now, just a form of projecting religious mystical magical beliefs on evidence.

There are adaptations to the environment that cause the skin to be darker or lighter, people to adapt to bad foods, and bad air, immune system responses, the race to be taller or shorter, but they are always the same genus with variations. There is only cause and effect in natural science, not magical nonsense.

Here is what science does not know in the DNA (particularly on humans):  Where these differences in the DNA are manifest from. They do not see or understand the cause from parents to offspring. They see "results" shown in the DNA and are ignorant enough to think DNA is causal to its own manifestation.  Nothing is causal to its own manifestation.   

Is it ancient traits from 2000 year old ancestors that is in the programming of the DNA and now is being manifest for the first time in 2000 years (and they assume it is this "new mutation")? Is it from a 200 year old ancestor that is now just showing after all these years and looks like a new "mutation"?  Is it from a mix of the parents DNA, homogenized into these new "mutations". Is it because of a dominant gene in a parent that is overriding the other parent and does that dominant gene come from great (or 4 generation) grand parent? This is what is hidden in the DNA that cannot be seen at the present time.  I have seen many people (in my 61 years) who look just like their great grand parents.  It is a hobby of mine to look at old family photos to see the "genetics".  It is pretty amazing to see a great granddaughter (or G-grandson) who looks just like her great grandmother (g-grandfather).

They, absolutely, do not know where these "new", (acutally just different) traits, shown as changes to the DNA, come from or if they are hidden genetic traits from long dead ancestors, triggered by some event. 

But we know that the offspring are always humans and that each human being is totally unique in its make up. There have never been two people exactly alike, because that is the impossibility.
If you have objective evidence that shows something I don't know, then show it.
There are no "accidents" in the physical world. Everything is cause and effect.


*The foundational scientific meaning of mutation is something that is way off from the parents. Normally a "mutant" has "bad genes" as is common but it really means the chromosomes are not correct or symmetrical (equal number from both parents), or there is one or more or one or lesser numbers of chromosomes.  These "mutants" fail to breed into the main stream of the genus or if they do breed their offspring do not make it. This idea of mutation causing a new genus by some accident is part of what I have read in the evolution papers.  This has no evidence to even state such a ridiculous conclusion.

The use of the word "mutation" is deceptive in my opinion, from being involved in scientific study for over 47 years and 41 years on this subject.  When used to describe minor natural differences in the genome that are not out of balance or are not unusual for all the circumstances.  A new word needs to be considered to refer to this rather than screw up the definition of a perfectly good word that has existed for over 100 years before they changed the meaning in the last 20 years.  There is something ethically wrong with changing the definitions of foundational scientific words that has had specific meanings for so long.

Since this is a new phenomenon that has no equivalent word in any of science that fits what is really going on:
Why not "Adaptation and Traits"  =  "Adtraits" shown in the genome, because this fits what is really happening and is a new word that is designed for only that phenomenon and does not confuse people?  Think about it?  "Differernces" is actually the best word.

The new "adtraits" or "DNAdiffs" which are the adaptation part, are not ever explainable by random changes, because there is no such thing as random.  They are cause and effect and follow the laws of logic and reason. So far all of the new "adtraits", "DNAdiffs" are caused by adaptation to the environment after birth for the creatures to survive as the same creatures.  All the other changes are from genetic information and traits passed down.  Anything added for survival is for survival as the same creature. There is no "intentional" or "programmed" evolution in any creature.  Adapting to survive as the same species is not evolution, by basic definition of "evolution".

(This is why I opened this forum so we can post up to 15,000 characters and to be able to finish a thought.)
;D ;D

I say mutation is "loaded" because people typically think of them as being negative when in many cases it is improper to apply a value judgment, they're just changes, nothing more. Mutations that produce clear deleterious effects are clearly "bad", and that's fine to call them that. It's just important to understand that they happen, for several reasons, and we know this to be true.

These are changes to the genome, but the science of genetics really doesn't have full understanding.  There are adaptations to the environment that cause the skin to be darker or lighter, people to adapt to bad foods, and bad air, the race to be taller or shorter, but they are always the same genus with variations.
Here is what science does not know in the DNA (particularly on humans):  Where these changing traits are manifest from:   Is it ancient traits from 2000 year old ancestors that is in the programming of the DNA and now is being manifest for the first time in 2000 years (and they assume it is this "new mutation")? Is it from a 200 year old ancestor that is now just showing after all these years and looks like a new "mutation"?  Is it from a mix of the parents DNA, homogenized into these new "mutations". Is it because of a dominant gene in a parent that is overriding the other parent and does that dominant gene come from great (or 4 generation) grand parent? This is what is hidden in the DNA that cannot be seen at the present time.  I have seen many people (in my 61 years) who look just like their great grand parents.  It is a hobby of mine to look at old family photos to see the "genetics".  It is pretty amazing to see a great granddaughter (or G-grandson) who looks just like her great grandmother (g-grandfather).

They do not exactly know where these "new" traits come from or if they are hidden genetic traits from long dead ancestors, triggered by some event.  But we know that the offspring are always humans and that each human being is totally unique in its make up. There have never been two people exactly alike, because that is the impossibility.
If you have objective evidence that shows something I don't know, then show it.

This is way off base. We're not talking about 'traits'. That is further down the road. Mutations occur all along the genome. Within coding and non-coding DNA alike.

We also know of several mechanisms that cause mutations, and we only need one for the sake of argument.

AXIOM: The DNA passed from parent to offspring can be different.

Since this is a new phenomenon that has no equivalent word in any of science that fits what is really going on:
Why not "Adaptation and Traits"  =  "Adtraits" shown in the genome, because this fits what is really happening and is a new word that is designed for only that phenomenon and does not confuse people?  Think about it?

This is premature in the conversation AND probably a bad idea. "Changes" is a fine word. They can be "good changes" and "bad changes" and "apparently neutral changes".

Do you agree with this?

;D ;D

Quote:

This is way off base. We're not talking about 'traits'. That is further down the road. Mutations occur all along the genome. Within coding and non-coding DNA alike. We also know of several mechanisms that cause mutations, and we only need one for the sake of argument. AXIOM: The DNA passed from parent to offspring can be different. They can be "good changes" and "bad changes" and "apparently neutral changes". Do you agree with this?

You cannot talk about DNA and not include traits, because that is all the "baby" has when it comes into existence. The "cause" of the baby is the genetic information and traits of the parents, mixed with the poisons or good nourishment, including emotional distress of the mother,  taken during the pregnancy.  That is all you have, nothing else.
If you "see" some magical cause or event, you certainly have no evidence and if it violates the laws of physics, I tend to put it in the human garbage pile of crap beliefs.

There can only be "traits" and information passed from parent to offspring. There is no other possibility.  This is well known in genetics.
As the creature goes through life, it may make adaptations and there is an obvious "timing" that triggers events in the genome, such as old age and death, genetic caused diseases that strike at almost the same age in the parent as in the offspring and such.  Adaptations to the environmental toxins or removing toxins from the environment and a genetic coding,  may trigger cancer, but the cause has it roots in the genealogy, not in some random magic.



The ability of creatures to make changes to survive as the same creature is pretty obvious.  The only thing that is for sure is change based on logic and reason and events and that survival of the creature is built in to the "design".

(Every creature passes traits, but the offspring have never shown any great changes over even millions of years in the fossil record.)

What is thought to be random "mutations" are neither random nor are they mutations. They are manifestation of the programming in the DNA and environmental adjustments, that can be retro or can come and go as the need of the organism changes.

There are no accidents or random "mutations" because random is not even a scientific possibility in the physical world.  There are only causes and effects in the real world.
Again "random" in the genome is instant death.

Magical thinking is not part of real science.  This is one of my axioms which I prefer to call "absolute truths of science".

;D ;D

Quote:

You cannot talk about DNA and not include traits

YES you can. Traits only emerge from DNA that is EXPRESSED. Most organisms have far more DNA that is actually used. There are long stretches of non-coding "junk" DNA that does not get used. This DNA mutates too.


Quote:

There can only be "traits" passed from parent to offspring. There is no other possibility.  This is well known in genetics.

As I said. The parent passes DNA, that is often slightly changed.


Quote:

The ability of creatures to make changes to survive as the same creature is pretty obvious.

Same creature??? You just said earlier that no two individuals have the same DNA (except for twins maybe). So how can you call them the "same" creature.
They are very similar. If they are similar enough they can potentially produce viable offspring. This is how we define species.


Quote:

What is thought to be random "mutations" are neither random nor are they mutations. They are manifestation of the programming in the DNA and environmental adjustments, that can be retro or can come and go as the need of the organism changes.

So you're saying DNA copying errors are planned? What protein steps in at the right time to fudge up the copying process. NONE. This is not the case. DNA copy errors just happen (along with all of the other mechanisms of mutation).


Quote:

There are no accidents or random "mutations" because random is not even a scientific possibility in the physical world.  There are only causes and effects in the real world.

I also have a feeling that there is no true randomness. It is clear to me that nothing escapes causality. BUT! BUT! The universe is so fantastically complex we see all sorts of phenomena that are, for all intents and purposes, random. Snowflakes all show structure and yet all are unique. They assemble according to the rules of physics and chemistry but still, they're all different, all essentially random.
Mutations are the same way. We can't know why or when DNA will mutate. It could be caused by a high-energy photon from a star 100 light years away, or it could be from a copy error. These things happen and even though they still obey physics, they engine is essentially random.

AXIOM: Changes to DNA occur "randomly" (both of us agreeing the idea of random in the physical world doesn't make sense, but the level of complexity makes the events we see essentially random).


Quote:

Magical thinking is not part of real science.  This is one of my axioms which I prefer to call "absolute truths of science".

You use the word "absolute" quite often. "Absolute truth", "absolute evidence". It's interesting because it opens into the philosophical realm and that is not useful to us. I don't know that we can know anything to be "absolutely true". You'd always have to leave open the possibility you're being deceived by an evil genius with the means and the motive. I don't think this is the case but I don't go stomping around talking about absolutes.

;D ;D

wrote on Nov 18^th, 2009 at 7:34am:

Quote: You cannot talk about DNA and not include traits YES you can. Traits only emerge from DNA that is EXPRESSED. Most organisms have far more DNA that is actually used. There are long stretches of non-coding "junk" DNA that does not get used. This DNA mutates too. [quote]There can only be genetic information and "traits" passed from parent to offspring. There is no other possibility.  This is well known in genetics.

As I said. The parent passes genetic information that causes the DNA, that is often slightly changed. [/quote]

It is very difficult to get past people who are educated into this nonsense.  It is sad to see people so sure of delusions.

There are several several logical fallacies in a row, that are obviously based on belief and assumptions that are "one way" logic and are not purely logical, nor based on objective thinking.  I really think you are a nice person and you should not take this personally because most all people on earth suffer from this. Belief first, creates the view of anything including science. Get rid of all beliefs and you are a real scientist.

The word "Changed" implies magic changes from what the parents are transferring to the offspring.  In order to call it changed from the genetic information of the parents you have to prove that with evidence. To do that you have to go back in the genealogy of the parents and look at the DNA of all the prior generations, looking for that same exact pattern that you call changed.  If it is in an ancestor of the offspring or parents, then it is not changed but is actually transmitted down the genealogy by a process you don't understand.

"One way" means that the mind has an agenda, belief, philosophy, religious thoughts, and is tainted towards the belief. I have avoided this like the "plague of mankind" for most of my life.  If you really want to know what I know then it is up to you to take advantage of it or to keep the barriers to communication in control.

This is obviously the idea that "evolution must be true" is  belief, and anyone reading this can see it.   No one really proves much if they don't examine all the plausibility, from all "angles" that present themselves to you, right in the evidence.

You see differences and automatically the belief "kicks in" and "it must be evolution" from "random mutations".  That is not science.  it is really stupid to assume evolution is true until you actually can show even one peice of evidence to make it obvious.  The truth of the matter is always "self evident" to anyone with a "room temperature" IQ.

One way thinking only projects the belief and can't see any other plausibility.  This is common with all people, but particularly bad with evodelusion.  It is the nature of humans to want to believe things they are taught from "authorities" and "nice people".

Religious people have their agenda.  Homosexuals have their agenda.  Angry people have their agenda. Feminists have their agenda, Buddhists, Jihadists and Evolutionists have their agenda.  When a belief is disguised as science or "truth" it is harder to see with pure logic. I have never allowed any belief to control my thinking.  This was taught to me early in my life by my father.

Here it is from the Buddha. This is one of those absolute truths that become more apparent as you test your beliefs to see if they are real or not.  Most people are cowards to actually test their beliefs, because they are emotionally and irrationally based.

The Buddha paraphrased:  "Don't believe any book, and sacred text, any science book, any scientist, any authority, priest, preacher, lover,  any teacher, anyone anywhere.
Find the truth for yourself."
 
It is funny to see Evolutionists tell other religious people that they are not scientific, when I see evolutionists are not at all scientific either (There is no use of the scientific method in Evodelusionism.).
There is about 10% science factual truth in the theory of evolution. This science fact is based on genetics that we already know 90% of.

The rest Is obviously a projection of what they believe is happening,, based on brainwashing and not objective observation.

That 10%, backed by real evidence, holds up the other 90% that can never be proven or tested. So this belief system keeps on perpetuating itself one generation after another.

If you can recognize this principle within yourself, you would make a tremendous leap in science that would make you some sort of hero, like Einstein or Newton.  If you keep with the "program" to be "safe" then all you are is "the program".  "The program" has always retarded science.

It is possible to learn all that mankind has to offer and never believe any of it until it is absolutely prove to you personally.
Finding the truth means to examine what you believe and be courageous enough to put it to the scientific method.  I have not seen much use of any scientific testing on old fossils, or most anything in this pseudo science.

"A man should look for what is, and not for what he thinks should be."
Albert Einstein

People who are taught this one way (twisted logic) logic are not objective any longer.  It is a taught thing and not tested at all.

As soon as you express belief in something most objectivity is gone.  These are facts of human behavior.

Thus the logic is not clear and does not see other obvious possibilities and probabilities.  This is not pure science but is the "expression" of belief that is forcing the logic to fit.  To me it is really sad to witness so clearly and yet have no ability to help people with this problem, unless they have the capacity to listen and learn from me.



There can only be information and traits passed to the offspring. The DNA does not come from some magical random nonsense.  The DNA is traits passed and information, whither you can see that or not is not my problem.The genetic instructions in the DNA can only come from the parents. There is no random in the universe.
 
"Junk DNA" is not even a tested principle. It can't be tested unless you have 3.2 billion people watching ever split second of life.   
Scientists have shown that "junk DNA" is not junk but rather has trigger that cause traits to express.

You cannot watch every tiny action within the DNA to see if it hasn't already expressed, or is just waiting to be expressed by the encoded timing within the DNA.  Maybe the "junk DNA" is the process of death waiting to be "expressed".

If a, so called, junk DNA expresses one time, and that is the programing it is supposed to do, then you would never see it.  This idea of "Junk DNA" is just an expression of belief in random and in evolution that is not proven.  Using preconceived ideas and projecting it on evidence is a big human problem.

The other part is that these DNA transferals to the offspring do not match the parents exactly.  So what?
If it is an homogenizing of the parents genetic traits. And as I said much of this "mysterious" DNA can be from the deeper programming that you can't see in the DNA and represents genetics that is from long long ago.  Which to me seems obvious. The foundation of DNA seems to be much deeper in the unseen regions of the creature.  There are no magical mystical events in science.

The DNA may actually be an "Expression" of another level of programing that you can't detect. Just like when we had no way to see bacteria and no way to see DNA, we also have no way to see any deeper into the structure of life at the present time and we think "this is all there is". It is an utter logical fallacy to think our instruments can detect this. And it is utter logical fallacy to think DNA is the "final frontier" of genetics. That is what they thought with Chromosome studies.

I call this the "Monarch Butterfly Conundrum".  There is no evidence in the DNA that tells any scientists how it is possible for a Monarch Butterfly to fly to an exact location when they have never been there before.  Even when you take many of them far off the track by 1000 miles they will still go to the same spot and meet up with the other Butterflies before they even cross the border into Mexico. They speed up in order to do this because it seems the programming is etched in stone to arrive at the prescribed time.  This is not some miracle, it is obviously in the programming of that species of butterfly. It cannot be seen in the DNA at all.

There is obviously something deeper going on in organic life than just DNA studies cannot answer.
You are on the basic levels of genetic study and you think you are advanced.

;D ;D

Quote:

There can only be traits passed to the offspring.

NO! NO! NO!
Remember cause and effect. Offspring start out as a cell with a strand of DNA. There are no traits. Traits are the result of gene expression and the developmental process.

We have to be solid on this. DNA is what is inherited.


Quote:

The DNA is traits passed,

No! This is a distinction you must learn. DNA is a sequence of nucleotides. It doesn't have any meaning except in the context of gene expression.
DNA  ==> A strand of nucleotides.
Traits ==> The product of gene expression and development.

Stretches of the DNA don't have start and stop codons, and so there are no genes present. These stretches of DNA don't confer any 'traits' to the organism.

Do you understand this?

I am still working on breaking down your last post into understandable segments for you.  Your statements, so far, do not have a presupposed level of truth to start with.  In order to proceed, you have to prove basic premises used to support what you are saying so far.  I would need a lot more than a wanting to find the truth in my nature.  Remember I was taught to never believe any authority of any kind.  In most homes parents teach beliefs in all sorts of ideas as "presumed true".  My father, in particular taught me to never believe.  He was like The Buddha in that philosophy.


Quote:

YES you can. Traits only emerge from DNA that is EXPRESSED. Most organisms have far more DNA that is actually used. There are long stretches of non-coding "junk" DNA that does not get used. This DNA mutates too.

There is no way to know what is really going on and "far more DNA" is not an understandable part of DNA , because what is contained in "non expressed" DNA cannot be know until it expresses physically.  It may have another function besides expression.  Science does not know this for fact. The presumption is that it "must be out of date" DNA from evolution.  That can only be presupposed if you already believe in evolution, because it is not founded on any lengthy work with DNA. Considering DNA is a new science and there are Billions of pairs to "watch".  There has not been enough time for enough people to witness enough of how DNA works to make any conclusions like that.

The "perspective" of belief will cause people to force belief on things they really don't understand.  If there is ever the possibility of "gray area" evidence they color it with belief.
If evidence is obvious and extremely clear you cannot "adjust it" to fit the belief. This is called absolute evidence.

If something is absolutely true, then it has absolute evidence that is irrefutable, obvious and easy for a logical person to understand....no "gray areas" to color with belief.

There is no such thing as "random mutations" in the genome.
Random they are not and mutations they are not. 

Random causes for DNA = instant death.  You have to be the most ridiculous teacher I have ever met.
If one change to one tiny base pair can cause sickle cell anemia, then 100 random changes equal instant death.
Are you really that ignorant of the laws of science?
Random is not a scientific word.  I want you to go randomly into your kitchen.  Have someone place five poisons on the counter and five good foods. Put a blindfold on and go in and choose to eat six of them by just guessing what they are and eat six of them.  You will die for sure.  This is one of your ideas of random. 
;D ;D

Ok so it looks like we need to make sure you understand what a gene is.

Genes are stretches of DNA that begin with a "start" codon and end with a "stop" codon. Only DNA with a valid start and stop the appropriate number of nucleotides in between can be transcribed for later use.

There are large stretches of DNA that lack valid setup for transcription and some stretches that aren't expressed for other reasons.


Quote:

because what is contained in "non expressed" DNA cannot be know until it expresses physically.

This is not true. Many genomes have been completely mapped. They know exactly where all of the valid gene segments are. We know where genes are and aren't. And they're working on predicting what the proteins / ribozymes will do once translated from those genes.

Here is a picture of DNA for illustration sake. (+) is a gene (-) is NOT a gene.

-----+--+---++--+-+------+--+-----+--+-+--+------

You see? Some stretches of DNA are genes, and some are not.

Quote:

"This is not true. Many genomes have been completely mapped."

Mapping is not the same as watching for the moment this DNA comes to use.  This has not been done.

We know that many of these "symbols" in the DNA are not know as to thier function, because they never see them function.  If the conditions that caused them to function historically in the passing of traits, are met, then this DNA will express itself.
But you have no idea where that expression came from nor the cause of it, but you have your beliefs.

You need to read my stuff a couple of times.

Quote:

We know that many of these "symbols" in the DNA are not know as to thier function, because they never see them function.

What symbols are you talking about? Could you please use the nomenclature of the field. There aren't any symbols in DNA, just 3 nucleotide codons.
This seems like a deep and grave misunderstanding you have, and it is absolutely fundamental in biology.


Quote:

If the conditions that caused them to function historically in the passing of traits, are met, then this DNA will express itself.

Why do you presume non functioning DNA functioned "historically"? This can not at all be assumed. Stretches in non functional DNA can arise in many way, they're not all de-activated genes once used.


Quote:

But you have no idea where that expression came from nor the cause of it

Umm.. we know gene expression is caused by the correct promoters activating the regulatory region, allowing the structural region to be transcribed for use. This is better understood than GRAVITY! Haha.


Quote:

but you have your beliefs

No! No! No! First of all this sort of statement is petty and dismissive. Secondly this knowledge of gene expression is based on thousands of man-years of research. This process is so well understood scientists are able to make glow in the dark pigs, and control the brain of a mouse with fiber optics with the genes from light sensitive algae. This stuff experimentally works over and over and over.

It's seems we have reached our first impasse. We can not continue further until the matter of DNA and gene expression is resolved.

The language you use to describe these concepts gives me the impression that you don't understand it, and what you are told you automatically chalk up as irrational "beliefs".

So cite something SPECIFIC that is unknown that has some bearing on the topic at hand. We're talking about DNA being inherited from parents, and being slightly different. And how the expression of the genes in that DNA produce traits in the offspring. Where is your problem with this?

;D ;D
It is difficult to get past your non founded beliefs, based on no scientific evidence and only your projection of what you think you see.  Evidence that is obvious is very hard to see when you are blinded by belief.

The problem for you is that you have a foundational belief that what is contained in the DNA supports the idea of evolution. 
You have no understanding that DNA is not the cause of DNA. Nothing is the cause of itself.  I find that almost funny.  ;D Good for a chuckle or two, but really it is sad to think that science is THAT retarded.


Semantics of scientific terms is a dodge of the questions.
This an important post for you to understand.  You cannot take someone who has no beliefs into a position of belief without "one way" evidence that has no other possibilities.

In order to prove something each part of the "evidence" must have no other ways of testing it, either by experiment or by logic.  If you have not tested this idea by going back in the genealogy of any test subject and looking for where this "new" DNA came from then you are not a scientist at all.


It does not show anything random nor fluid!  It only supports what is actually seen and documented.  So, far all it shows is what you call junk DNA that you don't know what it is, and DNA that produces the building blocks of the cells.  That the DNA of the offspring is different than the DNA of the parents, but the only place where this DNA comes from is the parents.

Any changes to the DNA as far as I can tell are from environment and long after conception and birth, so that the lineage of creatures can survive as the same creature. 

Any "random" changes to the genetic structures of creatures is equal to instant death.  You already know that one change to the DNA can cause sickle cell anemia. If you allow random changes then there is ONLY the inevitability of death. Don't you realize that creature have genetic structures that identify them, represent the cause of them to exist, and any mutated not controlled random garbage genes will cause death. This is one of those absolute truths that are in the evidence of all creatures that have ever existed that we can test. 

The foundation of the creature never changes until it goes extinct.  It may get bigger, smaller over time, have organ changes needed, have stronger immune systems against the poisons,  but that is only because of the environment, food, weather, water availability, amount of light, intensity of light, etc.  If the ability to survive as the same creature, is exceeded then it goes extinct. This is shown over and over in the fossil record.  Creatures come, remain the same (for up to 50 million years) as the same genus with spread out species from the same genus, then we get extinction as the world changes too much for that genus to continue.  That is what is shown in evidence. There is no lineage of creatures that have ever broken the boundaries of their genetics.

My hypothesis on the chicken teeth (and many other "old features"), for instance,  is that at one time they were needed.  After domestication they don't need them. If all humans die and can't feed the chickens any longer; they revert to the teeth to survive.  In other words (your concept of evolution) is really reversible as needed for the species to survive as the same species. It is not some "one way" towards more complex always. This disproves the basic premises of Evodelusionism.

If you change the food of this "wall lizard" back to the original food the stomach will revert to what is contained in the DNA to be able to eat what is available.  It is not simply a one way path towards more complex as is the theory of evolution. The only thing shown in real evidence is survival and some adaptation, then extinction.

That has nothing to do with this idea that creatures can evolve into an entirely new species with new organs,new legs, or new wings over some immense time. There is no objective evidence for this. It is a fairy tale that has no evidence.

I thought we were discussing evolution not genetics.  Genetics does not support evolution. 

All that I have read on this topic does not show or suggest evolution but only adaptation of living creatures to the changes in and around them.   This only shows or suggests a deep survival "need" built into the "design"  of the creature as the same creature to adapt and survive as the same creature.  It's "purpose" is survival not evolution.

There is no fundamental need for a creature to evolve, but there is an obvious need to survive.

The fossil record as screwed up as it is, does not show evolution of anything.  If you have only dead ends, extinction, and belief, and no continuous trail of "specialtion" that results in entirely new genus and not even in the same family then you cannot prove evolution.  You can't even get close to suggesting it.  You must never fill in gaps with religious mystical magical ideas that there must be evolution.


You must know that before you can proceed you must make a better foundation than this to proceed.  Your foundation requires a "pre belief" which is not contained in the evidence. This pre belief  that this DNA suggests evolution and you have not established that for anyone on here.

In math they start with addition, subtraction, first which is the foundation of that study and it is proved by using "things" to count.  You have not produced any basis for thinking that changes in the DNA - genome represent evolution of any sort.   You have to get some better foundational evidence of the "addition and subtraction" that would make it possible for the "multiplication" to seem real.

You are "suggesting" multiplication but you have not proved and basis for the "multiplication". Do you understand.  You have no empirical evidence to back up your unsubstantiated beliefs so far.   IF you can't do that, then try another angle and stop before you start sounding like a religious nut case.


I do not have any beliefs and I never accept them from anyone.  Not even from all the cartoons of so called creatures from the past that are created from tiny distorted bone fragments.  The TV, Discovery channel, the cartoons, the books do not have any real evidence for evolution with which to take your ideas and "project" them as any sort of evidence that:
All life came from very tiny life that somehow magically evolved into all the variety of life we have now.

The only thing that is implied in all the evidence is a parent genus that adapted and changed over some time, but it never lost its trail of geneology.  No reptile has ever been shown to change into a mammal, for instance.  No fish has ever changed is genetic make up to become a land creature.

If you think that changes in the DNA from one generation to the next is your definition of evolution then it does not fit the "real" definition and you have not shown any evidence at all, just this false idea of "random mutations" that violates the laws of physics.

You still do not know what these changes showing from parents to the offspring mean.  The supposition is from the projection of belief.

They use of the word "symbol" is because the actual understanding of these DNA expressions is not actually understood by anyone.  The foundation of the gene expression is only seen from the surface, and remains a total mystery, until you can establish why a specific type of cell is produced from the base pairs that have not expressed.

This is that "Monarch Butterfly" principle or another unknown to science.

If these changes in the DNA are not some progression into a new species,but are simply passed on genetics only, which they are, then humans don't evolve, they just adapt to survive as the same species.  Which the DNA also would suggest if you have NO pre belief that this is some form of evolution.

I hope you understand this because it is at the base of how people get screwed up with belief and continue to project it on everything, which retards science. 

Belief is a horrible thing in my opinion for any scientist.  As soon as belief becomes in control you are no longer a scientist.

You have not established anything that would even suggest evolution.  So, you may want to think about how to go deeper and establish a foundational "understanding" that fits with the theory of evolution and has no other plausibility.  In order for something to be true, it must have no other plausibility.  That is a rule of science.  All roads tell the same story with no other possibility or it is simply not proven and so you don't believe. And you must not leave any method of testing out of the discussion, simply because you fear it or you don't think it is science, or any reason. There is never any reason not to examine the evidence from other perspectives besides a dumb belief that is totally not proven. That is really as ignorant as a scientist can get.

"A man should look for what is, and not for what he thinks should be." Albert Einstein


Can you please go deeper and find the source of your belief first, because your belief and irrational conclusions are not contained in the evidence.

The evidence can mean other more obvious possibilities that you are not "looking for".  If you eliminate any other plausibility you are not a scientist, but are only seeking to perpetuate belief.

Belief is the number one destroyer of scientific inquiry.
;D ;D

Quote:

Why do you presume non functioning DNA functioned "historically"? This can not at all be assumed. Stretches in non functional DNA can arise in many way, they're not all de-activated genes once used.

I don't assume.  It is obvious that if it is in the genome it got there from the parents. So the only way for any DNA to be produced in offspring is from the parents.  The changes to the DNA as the creature goes on in life are from reactions to the environment and are always active DNA that expresses in the cells, not from the original DNA encoding.

If there is non functioning DNA then it must be old and not needed.  So, what? Science works on logic and reason not belief. 

Quote:

What symbols are you talking about? Could you please use the nomenclature of the field. There aren't any symbols in DNA, just 3 nucleotide codons. This seems like a deep and grave misunderstanding you have, and it is absolutely fundamental in biology.

From my discussion with you, so far, you are not capable of seeing just what IS there in the DNA. So, who is it that doesn't understand biology?
Making insults is not going to work on here.  "symbols" are used in all of science, in case you are not aware of that.

The photo below is a "symbolic representation" of DNA

http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif

:) :)

Quote:

Semantics of scientific terms is a dodge of the questions.

I can't talk to you about calculus unless I know you have a firm understanding of arithmetic.


Quote:

I thought we were discussing evolution not genetics.  Genetics does not support evolution.

Evolution is claimed to be the gradual change of living things correct? Which get their shape and function via genetics correct?

It's like you want to talk about swimming the English channel but discussing water is waaay off-topic.


Quote:

If you think that changes in the DNA from one generation to the next is your definition of evolution then it does not fit the "real" definition.

I've never claimed any such thing. I've just been trying to keep things simple and to the point and nice and slow, so we can forge mutual understanding.

I want to put together a list of Axioms that we can agree on. Build this list longer and longer until we reach one we can't agree on. And then we'll talk about it.

You don't really want a conversation do you?

It sure doesn't seem like you do. Especially when you post these 3000 word tirades about how entrenched I am in my belief system and how you're enlightened and above all that. All the while ignoring my questions and making excuses the rest of the time. Or posting a 3d rendering of the chemical structure of DNA and calling it a "symbolic representation", which is nonsense AND was not in spirit with the original point, which is that there are symbols contained IN DNA.

It feels like getting anywhere talking this way would take months.

You really have to stop shouting. You really have to stay on topic. You really have to limit the conversation to concise questions and answers.

wrote on Nov 19^th, 2009 at 12:39pm:

You don't really want a conversation do you? It sure doesn't seem like you do. Especially when you post these 3000 word tirades about how entrenched I am in my belief system and how you're enlightened and above all that. All the while ignoring my questions and making excuses the rest of the time. Or posting a 3d rendering of the chemical structure of DNA and calling it a "symbolic representation", which is nonsense AND was not in spirit with the original point, which is that there are symbols contained IN DNA. It feels like getting anywhere talking this way would take months. You really have to stop shouting. You really have to stay on topic. You really have to limit the conversation to concise questions and answers.

You started with the insults and put downs.  You can never teach anyone if you put them down all the time and you make ridiculous assumptions about me that I find offensive.

I have been watchind and studing this for over 40 years, waiting for anything that would even suggest evolution as true.

I never insult in any conversation, until the other guy starts.  Then as soon as the first insult starts, I can destroy any low IQ person on any forum.  That is because, unlike them, I know what I am talking about.

On the youtube I started asking questions and so far nobody has the answer (but they certainly can insult and gang up like Nazi cult members) .  I have had long conversations with PHD's (relatively nice guys) in this science and they normally stop listening as you do and stop showing evidence because I will destroy any evidence that is not absolute and only has one conclusion. I hate bovine garbage, and I am not going to take it from anyone.

If you have evidence that is absolute and can only be interpreted one way and only one way then you would do well to prove your belief. Until you do that you are just another person who has been duped into a belief based on nothing but human weaknesses.

If you don't have any evidence that is nothing more than opinions based on belief, then you can stop now and well will simply say that the "theory of evolution" is nonsense.

I have read hundreds of thousands of papers on this over my life and all of them contain nothing but opinions on the evidence and no real evidence that can only be seen as evidence for this idea (and that is all it is) of evolution.
You have done nothing new. You have failed to establish a deeper level of understanding that would allow any of the DNA evidence to "suggest" only evolution.

If you have real evidence then bring it up for all of us to see.

It is up to you to prove to me that what you are saying is not just another belief system.  Since I have no beliefs, but only look at all of science from and objective stance, you have to prove it to me.  I have no beliefs, only what has been shown to be true do I ever accept, but not on any faith or indoctrination or need to belong to any culture or any society.  I am a free thinker. 

"A man should look for what is, and not for what he thinks should be.:" Albert Einstein

If your "evidence" has only one plausibility and you can back it with testing and solid evidence, having no other plausibility and can be tested over and over and always has the same results then you can then call it knowledge.

If it is belief; it stinks of belief.  You have not gotten to the first level of instruction, because you can't.  The belief is stronger than reality. You take huge leaps of faith and belief that I can't because I have no beliefs in anything that can't be absolutely proven. 

I only accept real evidence that has no other plausability.  If you see DNA as evidence for evolution then you need to start with some other "attack" or "approach". 

There are way too many other possibilities in DNA that are not "suggesting" evolution, but only show survival of a genealogy and nothing else.

You seem to think that any change in the DNA is equal to evolution and that is utter nonsense, so far.  It shows that you can't think beyond what you "need to believe" to keep your job or keep your status. It shows that you are not a real scientist, because belief destroys all credibility of any scientist.  Absolute knowledge is what I seek not some belief projected on "evidence".

I don't mean to insult, but you're just being frustratingly obtuse.

I still don't know what you do and don't know about genetics and cell biology. So we're ill-equipped to talk about anything more complex than that.

Children inherit DNA and cell machinery, NOT traits.
Mutation is a fact. DNA mutates.
DNA determines organization.
It's logical that if DNA can change then the organization can change.

I see that you believe in "adaptation", but from what I've read it's for the wrong reason. You seem to think that organisms have a built-in area of leeway in which they can fluctuate a bit, but that's totally wrong. So we need to get it cleared up.

So, without proselytizing , can you  quote the parts you don't agree with and we can get on with discussion?

This thread is dead. It never really had a chance I guess.

:-/

;D ;D
Produce evidence for your belief.

What empirical, objective, irrefutable evidence that is always true and only shows evolution; has no other plausibility.  It must contain no opinions!  If you state opinions then I will state all of the other possibilities that you don't look into.

It has been my experience that evolutionists never examine any piece of evidence by any other plausibility and only "see evolution" because they wear, figurative, "evolution glasses" that filters all the evidence and filters out anything that would ruin the belief. This has been my research study on this phenomenon.

In my science if there is any other plausibility that is logical, follows all the evidence that we know, and is just as solid as the "perceived" logic, then the evidence is negated as proof of anything.  It is just stored in the memory and we go on to the next piece of evidence.  Not proven, means not proven.

One by one, I have eliminated all the evidence for evolution as "NOT PROVEN" , "inconclusive" and basically worthless as evidence for anything similar to the theory of evolution. It does not even come close to the use of the scientific method.

If you want to try, we can go over each piece of evidence and I will explain it to you.  You can bring on all the experts you want, and all the videos you want and I will break them down for you as well.  If you want to be free, then you need to open your mind up to what is obvious and not to what has been taught from some form of human political authority.

I understand this far better than most anyone I have ever met.  If you want to learn what I know and improve your knowledge then take advantage of this opportunity I am offering you.  That is as straightforward as I can state it.


If you have the courage of your convictions you will continue to try and "educate" me.  In the process I hope that I can show you all of the logical fallacies in belief and how it destroys all objectivity and the true meaning of science.

Do you understand that the "evidence" in the DNA can be looked at in other ways, that are not "evolution" and that are more consistent with the actual evidence we have?

We only know that there are changes in the DNA and muations are not mutations.

I hate the fact that foundatoinal scientific terms have been bastardized by believers in evolutoin. They bastardize them to make them seem to fit the belief.
There are no "mutations" in the DNA there are only "adaptations and traits".  If you have absolute proof of otherwise then please present it.
For the most part science has no clue how this mechanism works and what is the programming source at the deepest level is.

You present an obvious belief with no foundation that would even come close to what is actually shown in all the evidence.  It is really a weak argument, but if you are a deep believer, then you think it is real.


There are no magical mystical religious reasons for anything in science.  I have never found any.  When someone uses, like you,  mystical answers that avoid and are contrary to the laws of physics, I have to say they are not scientists at all but religious fanatics.

;D ;D

The thread is dead.

Is this all just hilarious satire?

If so you're a genius!

I honestly can't tell if you're pulling my leg now.

Go back and read it all over again and again, until is sinks in.

Evolution is not science.  It is nonsense. It has no empirical absolute evidence.  It only has belief and projection of belief on "evidence".

I have empathy for  people who are indoctrinated into this nonsense that has no evidence, and are so brainwashed and indoctrinated.  It is really sad to see this crap pseudo science in my precious science. It degrades real and functional science.  It has added nothing to biology and has messed up medical science with confusion and bad prescription drugs.

That is why I am going to get it out of science.  It is a mythological religion, and it is extremely obvious to me. It retards any real science advancement in biology.  You cannot force belief on evidence and have good results.

If you want to get free of this delusion, I can help you, but you must take on the role of student, because so far all you have shown me is that your belief is strong, but has no basis.  This is obvious to me.

Eventually I plan on suing to get this crap out of schools.  No religion of any kind should be taught in classrooms and this qualifies as mythology.

If you have any evidence that is absolute, clear, irrefutable and has no opinions in it, then where is it? No gray evidence that has other possibilities allowed.    Why would you believe in something that is based on belief and opinions from believers, because there is one thing for sure: You do not have any evidence that would give rise to any belief in this as even close to being a science.  It is no more science than Scientology.

All I see on the field of arguments is vague inferences and trying to tie things together that are not part of any science.

Listen to these two videos and wake up! I am all for you breaking free of this nonsense and becoming a real neutral, and objective scientist, because your belief destroys your credibility and makes you not capable of teaching this to someone who has no beliefs in anything with no evidence. All beliefs in things that are not proved is bad for you. Retards your development as a human and as a scientist.

I advise all people to watch all of my videos.  If you are not completely brainwashed you may actually get free of one delusional belief.

I really wish all the best that life has to offer you. I really do. :) [smiley=thumbsup.gif]



http://www.youtube.com/watch?v=bQrkBtnD_UQ

http://www.youtube.com/watch?v=4--Frypeg00

Do you have a similar website about the evil and entrenched dogma of round earth theory?  :o

The more you type the more you reveal just how little you know about biology. I don't want into the auto shop and give the mechanics lectures about carburetors.. why? Because I don't know garbage about them! What makes you think you can challenge science without foundational knowledge.

I tried to work this slowly with you but you refused. Apparently you don't have time for facts. You must preach at your own pace and get the good word out to all of the brainwashed masses. This is truly insane.

Eviscerating the same invalid arguments over and over has been entertaining, and all of the Einstein quotes have been illuminating, but is this really all you have? You went through the trouble of putting together a website and videos and all of the HEMG nonsense and all you have is "a horse always gives birth to a horse".

I hope you're at least enjoying yourself. That's about as productive as this could ever possibly be.

wrote on Nov 20^th, 2009 at 9:54am:

Do you have a similar website about the evil and entrenched dogma of round earth theory?  :o The more you type the more you reveal just how little you know about biology. I don't want into the auto shop and give the mechanics lectures about carburetors.. why? Because I don't know garbage about them! What makes you think you can challenge science without foundational knowledge. I tried to work this slowly with you but you refused. Apparently you don't have time for facts. You must preach at your own pace and get the good word out to all of the brainwashed masses. This is truly insane. Eviscerating the same invalid arguments over and over has been entertaining, and all of the Einstein quotes have been illuminating, but is this really all you have? You went through the trouble of putting together a website and videos and all of the HEMG nonsense and all you have is "a horse always gives birth to a horse". I hope you're at least enjoying yourself. That's about as productive as this could ever possibly be.

You are starting to sound paranoid.  I know more about biology than you do and this is obvious to anyone reading this who has any awareness of reality.

I am exactly who I tell you I am.  You go read about it.

I have no religious affiliation and I certainly have no religious affiliation with the bovine garbage of Evodelusionism (my term for your religion.)

If you want to grow some brains and actually understand anything about biology or any science you have to remove all conflicting bovine garbage from your brain.  You cannot be a scientist if you have any beliefs that have no absolute evidence.

If you want intellectual muscles, you need to get free from delusions.  This has actually been shown that when you get your brain clear of nonsense your IQ goes up.

One should never seek to perpetuate beliefs that are not founded on absolute evidence. If you don't know what absolute evidence is, I  can teach you. :)

Quote:

I know more about biology than you do

Yeah. Your descriptions of genetics and mutation illustrate this perfectly.. LOL...  ;D


Quote:

Evodelusionism (my term for your religion.)

Oh here's a new word. I certainly haven't seen it in ANY posts you've made hear. Totally new. Wow, insightful..

Funny how you call this a "Neutral Evolution Forum" and then you already believe evolution is a delusion.

I have given you full power to post anything you want. videos, photos, quotes from PhD's (I love to answer those).
It is totally an open neutral forum for you and all your friends if you have any.
It is open to all who can just argue the topic, without breaking any laws.  I give you privacy on your identity as well.  I don't care who you are or what you think you know.

So far you are not doing well on the evidence thing.

What exactly is the evidence that has NO opinions in it and no faith and belief in it that would cause a sane person (tested) as myself to want to believe you?  So,far you seem really not aware of anything you say.  You don't even see the tremendous logical fallacies you "parrot" from other believers who brainwashed you.  It is like your were fed drugs and kept in a dark room with flashing images of "Darwin" and various birds and such, until you became brainwashed.

How is it possible that you actually believe this crap, when you have not given any solid evidence that would even suggest evolution.  You have to have your intelligence tied in knots to allow this abuse of logic in your life.

The "traits" of the offspring are contained in the DNA.
You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations.  There are changed to the DNA that reflect adjustments to the environment but those can be dropped as they are no longer needed.
Like the teeth in chickens could be needed if the environment changes.
Evolution is not even a consideration, because there is no physical evdence to conclude this. 
In the fossil record are only complete creatures that came into existence, remained the same, went extinct or are still here today as the same creatures with the same morphology, some after 125 million years.
There are no transitional creatures in the fossil record, unless you project belief on them.  Without belief they do not exist.
Get rid of the belief and be a free thinker. You will also become a whole lot more intelligent, when clear thoughts are all you have. 

What you do is to project your belief in evolution on all the evidence. That is a common human failing. And believing in human authority that has messed up agendas is part of your problem.

Quote:

The "traits" of the offspring are contained in the DNA. You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations.

Take a hypothetical gene.
In a parent, it looks like this:
atcgcaactctgaccagtactgcgacgtagtcatctgacggtacgtagcagctgagtcacag

And in a child, it might look like this
atcgcaactctgaccagtactgcgacgtagtcatcagacggtacgtagcagctgagtcacag

You see the change? That's a mutation. It's a pretty simple idea. These have been documented. It is a germ-line mutation.. so that strand of DNA existed in the parent for a short while, but the changed gene isn't in the parents genome. So it didn't "come from" the parent.

And I don't know what you think gene expression is, but it has nothing to do with heredity in this sense. It's about the promotion of genes within cells and the RNA / Protein products they produce.


Quote:

There are no transitional creatures in the fossil record

Every living thing is transitional.

Are we going to have a decent discussion on this?
I am sick of me doing nothing but stating the facts and Evodelusionist going berserk.  Can you remain on topic and can you actually read what I post. I give you the respect of reading all you post, you do the same. I don't want to ban anyone, I want an open discussion so we can all learn.


wrote on Nov 22^nd, 2009 at 11:38am:

Quote: The "traits" of the offspring are contained in the DNA. You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations. Take a hypothetical gene. In a parent, it looks like this: atcgcaactctgaccagtactgcgacgtagtcatctgacggtacgtagcagctgagtcacag And in a child, it might look like this atcgcaactctgaccagtactgcgacgtagtcatcagacggtacgtagcagctgagtcacag You see the change? That's a mutation. It's a pretty simple idea. These have been documented. It is a germ-line mutation.. so that strand of DNA existed in the parent for a short while, but the changed gene isn't in the parents genome. So it didn't "come from" the parent. And I don't know what you think gene expression is, but it has nothing to do with heredity in this sense. It's about the promotion of genes within cells and the RNA / Protein products they produce. [quote]There are no transitional creatures in the fossil record

Every living thing is transitional.[/quote]

"A guess is never an absolute truth."

You do not have a clue how the difference in the DNA of the offspring was established (how it was caused). That I know for absolute sure, in any creature bacteria prokaryotes, Eukaryota or  human or dogs .  This is because you do not know the cause and with your belief you try to make it fit your belief.  You see the results and make up what you think it is from belief and very limited knowledge.


There can be no random in DNA.  If it was random there would be no life.  Noting can be different than the cause.

You would have to be a moron to believe in "random mutations". This violates the laws of physics.

Random means there is no genetic structure that supports life.  Yet alll we have in evidence is supported by the laws of genetic stability and the transference of traits and information to the DNA.  There are no magical, mystical events in real science.  There can only be structure and science.  The genome is the result of the genetic information that you can see. The cause you can't see. When you see something in the physical that appears it is only the result of a cause and is never random.

You are extremely stupid and you do what for a living.  People trust a dumb ass like you to perform genetic science and you don't understand the fundamentals of physics??

What the hell are they teaching you?  Do they tell you that it is OK to believe that you can violate the structure of the universe, and its laws? 

If you can get away and back off on this belief that has no evidence then you can come into reality. When you don't know for crying out loud, admit it!!  ;)

There is no such thing as random in natural science, only in religious mystical bovine garbage that you believe.

Anything you can see in this universe is the result of a cause, and not random. When you look at DNA you see a result. You have no idea the cause of this different DNA in the human genome.  If you say that DNA is causal it is because of your tiny weak little mind, projecting your messed up Evodelusion beliefs.

Here is what I think this different DNA is. It is an "expression" of traits that are below the level that you can see. There is no such thing as random in the physical world.  Even your

high priests that go around fighting creationists for the cause of Evodelusionism state this. If you think there is random you are not a scientist. There is only logic and reason not fantasy and belief.

The only place where any construct of DNA or any information contained in the offspring can come from is the parents.  There is no other way it can get there that any rational person would think or could think. 

There is no magical mystical random mutation that takes place by accident.  It follows logic that ancient DNA patterns can be evoked in the reproductive process.  That these patterns are from pre-existing patterns and genetic coding that is the root cause of the DNA replication process in the parents (or any creature).

You are just too stupid to understand this.

Because what I say is far more plausible than some random event, my hypothesis is far more rational, but is still just an extreme use of logic that has no beliefs in it. Beliefs destroy all credibility in a scientist as they are no longer objective when belief is first and foremost.

Scientists are supposed to follow the rules of science and not make up crap from delusional beliefs. What is real is right in front of your face, but you can't see it because of the human emotional mental garbage colored glasses you wear.

Jut like in the old days they had no idea that germs existed. Just like we had crude microscopes that could barely make out images of bacteria, and now we have the ability to see DNA constructs. Some day we will see even deeper and find the real cause of this apparent difference in the offspring.
Right now any belief projected on this is just ideas with NO evidence and only OPINIONS and that is all. It is crap pseudo science.

The results you see in the DNA are not the cause.  Get it?


When someone projects opinions on evidence and thinks it is real they are not sane.

That is why I never do it.  I will tell you it is an opinion and only an opinion, but my opinion(s) makes a hell of a lot more sense than yours. Yours is tautology, indoctrination and group belief.  Mine is from keeping clear of people's beliefs.
And keeping myself clear of beliefs until the evidence is HARD, has no opinions in it, obvious and absolutely clear and irrefutable. 

My pure logical statements refutes any possibility of your belief as any more plausible than the tooth fairy.


Do you understand that when there is any other more plausible answer, it negates the belief?  This is pure logic and reason with no belief. Most people are not capable of this level of objectivity I have found.

Projecting the idea of "random mutations" on something that is not random is you belief and projection of belief, based on nothing but belief, because there is no evidence to back it and it violates the laws of physics.
No scientist would ever violate the laws of physics. But for some reason you do. Could it be that you are brainwashed and ignorant of real science?

When something appears that you don't understand you force your belief on it, automatically.  This is human nature; because humans cannot stand to not understand something so they come up with crap that fits their preexisting belief. (and it sounds so logical to brainwashed believers):  Human nature is to fill in the blanks with belief and think it is real.

It is better to stop projecting belief and wait for clear absolute evidence. I have never seen that trait in you so far.

It is possible to learn all that mankind has to offer and not believe any of it, until it is absolutely proven to you.
It does not matter if the whole world believes in some idea, if you have no absolute evidence of it, it is just "junk" to ponder but never form any solid opinion or belief on it.

If you don't know; you don't know. Admit it! and be free of this fairy tale.

I know for a fact that you nor anyone on the face of this earth knows how this "different" happens in offspring.

It is only because of infused (children are pressured into belief, like a social pressure cooker!) belief that you would think this was a random mutation and that is not evidence of anything.


http://www.ict-science-to-society.org/Pathogenomics/images/bacteria_cell.jpg

There are no transitional creatures in the fossil record.
And you say all creatures are transitional.

Where is my sixth finger that is supposed to be developing?
Where is my better forearm bones that should be developing?

How come I can't see any transitional features in my children or in myself.  There is no partial second thingy erectus that I should have. I could use it. 

You see how ridiculous your belief seems to me.

In the last 125 million years of fossil and specimen history in the fossil record (by the screwed up dating methods) there is not a single fossil with any partial development of any new feature, nor any slight indication of partial changes. Did you know that?  All that appears is complete creatures, distinct and not transitional. 

There is one bone in a fish that looks like it might be, but it has no objective answer in it, because there is no transitional fossils to or from it in time.

You must know what fossil I am talking about.
How can anyone believe this crap? How did anyone let themselves go so deep without thinking of the obvious and what is real?

None of what I teach is allowed to be taught in school, because it would ruin the indoctrination of this religion.
I think all religious beliefs need to be kept from all public schools.  If you want to teach this crap religion, teach it in your Evodelusion private religion schools like other religions do.

"The only thing that interferes with my learning is my education." Albert Einstein

Do you think he was kidding? Do you think humans have changed their stupid nature to some how need to believe in fantasy having become more "modern" now, and that does not apply? Crap they are dumber than ever.

"Just because some messed up authority, that you think might be real, teaches you to believe in crap, has never been evidence of reality contained in the classroom." GoodScienceForYou

"Seek your own truth. When you have absolute evidence of anything then you can say it is true." 

"Opinions are never to be considered to be absolutely true."

I wish you the best, really! :)

"collection of mutually shared axioms."

Axioms are not evidence, they are part of the indoctrination process that you think is science.

Why would you fall for that idea?

Unless you have absolute evidence nothing is real. :)

Re-read the long post. I fixed the spelllling errrors.

Quote:

Where is my sixth finger that is supposed to be developing? Where is my better forearm bones that should be developing?

I don't understand these questions. Could you elaborate?

wrote on Nov 23^rd, 2009 at 6:52pm:

Quote: Where is my sixth finger that is supposed to be developing? Where is my better forearm bones that should be developing? I don't understand these questions. Could you elaborate?

If you follow the "logic" of evodelusionism, we have very strong "evolutionary pressure" to develop more fingers. If hands are used for so many things and required for survival, then they would be showing signs of new appendages growing as we "transition" towards more evolution. 

This idea of transitional means transitional features have to show in the body.  There are none of these in any creature or any fossil.  I determined this long long ago as a prerequisite for any form of belief in this pseudo (unproven to even be science) science.


Now scientists, who are "rabid" Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?   ;D

Quote:

Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?

Does the strength of ones forearm often have implications on a persons chances to produce young?

wrote on Nov 23^rd, 2009 at 7:54pm:

Quote: Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind? Does the strength of ones forearm often have implications on a persons chances to produce young?

Watch this delusional weak human's:  Human emotional mental garbage in this  moron's video.
This is some of the crap for brain idiots spawned by brainwashing.  These guys need to get a room, that is what is obvious in this video. This Dr is in love.

http://www.youtube.com/watch?v=XAVyktynD_I

wrote on Nov 23^rd, 2009 at 7:54pm:

Quote: Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind? Does the strength of ones forearm often have implications on a persons chances to produce young?

Do you know that there is no evidence for evolution theory?
How can you not know this?  It is only based upon ideas and beliefs. There is no actual physical evidence showing any possibility of evolution of any life on earth?

Way to "side step" the question.

You're a hypocrite.

Direct question: Does the strength of ones forearm have any bearing on ones ability to procreate?

Selective pressure works that way. You don't know that. So how can you possibly argue against something you don't even understand.

wrote on Nov 24^th, 2009 at 6:31am:

Way to "side step" the question. You're a hypocrite. Direct question: Does the strength of ones forearm have any bearing on ones ability to procreate? Selective pressure works that way. You don't know that. So how can you possibly argue against something you don't even understand.

This video (above of Dr lover boy)  explains the belief, so you can understand it.
You are the side stepper and believer in pseudo science.
The reality is I like my arms and hands the way they are. They are amazing and I can do so many things with them.
You know that I play guitar in our band. I am the lead in HEMG. 
Do you know that the term "selective pressure" or "evolutionary pressure" (same meaning) has never passed a single scientific test.  It has never had any of the standard scientific methods used to test it.
Therefor it is not science. 
It is a religious belief that is brainwashed into innocent children and is part of the child abuse of taking crap beliefs and imposing them on "students" while avoiding all use of the scientific method.

This crap religion is disgusting and debase.  It destroys all credibility in anyone who believes this human emotional mental garbage.  You have no credibility if you believe in evolution. That is fact.  If you have any beliefs that interfere with your thinking you are not a scientist, you are a preacher of this delusional religion.

This is part of your fraud on the public and why this is crap pseudo science need to be in the garbage can.

Pay attention and read the titles and annotations to this excellent educational video.  There are many things you need to learn to get free of your messed up beliefs that have no basis in reality.

http://www.youtube.com/watch?v=BC1qruCbFIA

You make a lot of baseless claims.

wrote on Nov 24^th, 2009 at 11:52am:

You make a lot of baseless claims.

I am not a brainwashed believer in anything that has not passed a single use of the scientific method.

I you have detailed supporting papers showing how the experiment was set up and how many thousands of times it has been repeated to prove "evolutionary pressure" or "selective pressure" please show them to me.
I will perform the same experiment to verify the data.
That is how real science is done.
You are not a scientist until you provide the absolute evidence for this testing of this idea has been revealed.

You don't have the capacity to think any more.  Your brain is held down with belief.

I teach you what is obvious and you still deny it.  That is delusional mental problems for all to see.

You will remain a delusional person in the eyes of all who read this until you come up with the scientific test of this crap "axiom" of this HEMG religion.

If you can't test it or see it in action, then it is not real.  If you don't understand that, then, you are a lost cause. :'(

And if there is any contrary evidence to this idea of "evolutionary pressure" I will show it too you.  Because I have actually studied this and you haven not.

If there is absolute evidence that this principle is not even consistent or not usable in every circumstance then it is not proven: Just more human emotional mental garbage.
This crap religion needs to be taken out of schools. There should be no HEMG religions taught in school.

You are a coward if you don't show your absolute evidence of this idea of "evolutionary pressure" or "selective pressure".

You are not allowed to sidestep this.  If you do all of your cronies will see you as a coward.
If you quit this forum we all will know that you have no evidence of this.
You can use all the videos you want, use all the back up resources you can find. 

How is cowardice involved here? Anything I present to you you'll just explain away with some excuse you come up with.

Albinos and their prevalence in environments that suits them, and their rarity in environments that don't is perfect example of selective pressure. Albinos do great in the snow, it's a better color. They are more frequent. A pure white deer in a non-white forest doesn't live long enough to pass on it's albino trait. That's selective pressure.

wrote on Nov 24^th, 2009 at 12:15pm:

How is cowardice involved here? Anything I present to you you'll just explain away with some excuse you come up with. Albinos and their prevalence in environments that suits them, and their rarity in environments that don't is perfect example of selective pressure. Albinos do great in the snow, it's a better color. They are more frequent. A pure white deer in a non-white forest doesn't live long enough to pass on it's albino trait. That's selective pressure.

You don't answer my questions. You never do.  You sidestep them, and that is cowardice. :'(

There is no pressure in that situation.  It is simple logic.

The white deer in white snow has no pressure.

The white deer in the forest goes extinct.

In the fossil record we have the same creatures living today as 125, 70, 50 or whatever you want out to 125 million years.They are basically unchanged from the original of the genus.

Then we have a long list of extinction, with no trail of any creature evolving.

Your hypothetical "proof" just verifies what I have been telling you.  ;D

Quote:

The white deer in white snow has no pressure. The white deer in the forest goes extinct.

That's selection. You've got it!

This combined with descent with modification and you've got evolution. We did it!

wrote on Nov 25^th, 2009 at 8:45am:

Quote: The white deer in white snow has no pressure. The white deer in the forest goes extinct. That's selection. You've got it! This combined with descent with modification and you've got evolution. We did it!

It is not even a scientific term.  I find it funny.
You cannot call it science unless you can prove modification from the parent to the offspring. So, far you have only belief in some fantasy of unstable and fluid genetic structures that can in the real world of science only equal death.

There are many cases where it doesn't work.
Some of the weakest willy nilly short and dumb humans
seem to survive and rip off the strong smart and beautiful.
Is that "evolution" or is is survival of the greedy?

If it doesn't always work then it is not a scientific law.
If it is not a law it is not science.
There are no gray areas in science.  If you use gray, then your religoius belief will enter the science and cloud it up.

Evolutionary Pressure does not work in most cases and that is why there are so many creatures today that are identical to their extremely old fossils.

If it doesn't always or only a few times it "seems" to work, then it is not science.

If you can't produce a way to test it and have it repeat every time, it is nonsense and to be discarded.

Understand?  It is what we call "Happy Horse garbage"
Folk Lore from Mythological religions.  It reminds me of some guy on and old ship telling folk stories.

"Now gather 'round maties;  The yar  a stearn and the whales were a blowin' .............. and the magic dragon turned into a frog."
This is what this crap is.  Folk lore.

This is what most of this religious bovine garbage sounds like, because it is not science.  If you like religious bovine garbage, don't call it science.  You are insulting science with this. I is very disrespectful to all the great real scientist who came before you.

There is no instability in the DNA, it is programmed for survival, and can never be random without instant death. This is what is obvious in all the evidence. It is in every scientific paper I have read, even the ones supposedly that suggest evolution. 

Blind leading the blind. The sleeping instructing the sleeping.
The ignorant teaching ignorance.
;D ;D

"A law differs from a scientific theory in that it does not posit a mechanism or explanation of phenomena: it is merely a distillation of the results of repeated observation."

Universal Gravitation is a law (despite the strangeness of singularities AND that we haven't gone to other galaxies to see if the gravitational constant is the same).

Our understanding of the mechanism of Evolution is a theory. It attempts explain the physical reality of evolution.

You redefine scientific concepts to fit your arguments. Mutation for example. Mutation has no intrinsic value judgment. You swear up and down that mutations are "FREAKS" but it's just a change. This redefinition you keep doing weakens your position because it demonstrates misunderstandings of science.

wrote on Nov 25^th, 2009 at 10:58am:

"A law differs from a scientific theory in that it does not posit a mechanism or explanation of phenomena: it is merely a distillation of the results of repeated observation." Universal Gravitation is a law (despite the strangeness of singularities AND that we haven't gone to other galaxies to see if the gravitational constant is the same). Our understanding of the mechanism of Evolution is a theory. It attempts explain the physical reality of evolution. You redefine scientific concepts to fit your arguments. Mutation for example. Mutation has no intrinsic value judgment. You swear up and down that mutations are "FREAKS" but it's just a change. This redefinition you keep doing weakens your position because it demonstrates misunderstandings of science.

Are you really young? You obviously have not been involved in science very long so as to not know that these jerks have been changing foundational scientific terms to match a stupid belief?

In the real world of honest science we do not allow any of the laws to be avoided by delusional idiots who belief in fairy tales. We do not allow people to mess up scientific terms that are well established. 

When you avoid the laws of physics, we all know you are not running on all cylenders, and that you are cracked in the head.

There is a law of physics that there is no such thing as random in the physical world. That all events, actions, and energy releases have exacting results that are based on the cause.

Yet you delusional "head up the rear's" think there is such a thing as random events in the DNA.  You must be really stupid.

And the avoidance of this law somehow makes you the gods of science, when you are the turds of science.

There is no such thing as random anything in the physical universe.  This a a law of physics.  There is no "apparent random" either. That is like there is no "fantasy visions of lord Buddha on your head".  It is the same exact logic.

Laws of physics are irrefutable and obvious. They have all passed the intense testing of science and that is why they are laws. "For every action there is an equal and opposite reaction."  Why don't you crappity smack with that law and see how far you get?

I hate liars in science.

Attempt to explain is not evidence.  It is HEMG, and you are an HEMG believer and abuser of anyone who listens to you.

;D ;D

wrote on Nov 24^th, 2009 at 6:31am:

Way to "side step" the question. You're a hypocrite. Direct question: Does the strength of ones forearm have any bearing on ones ability to procreate? Selective pressure works that way. You don't know that. So how can you possibly argue against something you don't even understand.

I have to tell you that you are a not honest. You didn't even listen to the video and you obviously are not reading my answers.  The video answers your question. This idiot thinks that the forearm bones are a terrible design. Then he contradicts himself and realizes that it is so we can turn our hands.

I suppose we should have developed a way to synthesize titanium in our forearms.  As far as I know I have no metals in my body as construction features.

You are a really poor listener, reader. How did you pass any classes in school? If you don't know how to read or listen?
When you read my posts do you put on a blindfold?
;D ;D ;D

wrote on Nov 17^th, 2009 at 4:59pm:

creatures changing their DNA over some immense time into entirely new creatures.  That IS the question. Once again you're skipping far far ahead. How can we discuss such things without a collection of mutually shared axioms. It's like discussing mathematics and you have different symbols for all of the operations and you're using a base 15 number system. We can't get anywhere like this. You're really pushing the edge of my patience. Now do you want to work on building a set of axioms or are we done here?

A real scientist starts at the end and works backwards. This IS the scientific method.  The premise is that creatures can break the boundaries of genetics and "mutate' into a  new genus.

When you examine all the evidence, we can easily see this has never happened in any creature. There is no evidence for this.

What evodelusoinist  do is to build fairy tales, construct delusional axioms that violate the laws of physics and brainwash students.

When you are taking a ride in the back seat of a stranger's car, don't you think you want to know where they are taking you?  And don't you think the idea of putting blinders on so you can't see out the window is a bad idea?

A real sceintists would take a look at the premise and make their own mind up what "evidence" this would require.

My father taught me that.  When I first looked at the fossil record I realized immediately that those 'paleontologists" were delusional believers.  They were simply looking at fossils with absolutely no idea what those creatures were, and making up fantasy about them.

The first time I saw one of thier fantasy "reconstruts" cartoons I was disgusted that anyone would do that.
It is absolutely impossible to know what those distorted cracked broken fossils looked like when they were alive. It is fraud to do that. That is why I only look at these cracked and distorted fossils and make up my own mind about the.

If you have to have the "truth" spoon fed to you, then you don't have enough intelligence to determine on your own what is truth and what is human emotional mental garbage.

You are then not qualified to be a scientist.

If someone feeds you a bowl of food that smells bad then puts a pile of sugar and spice (delusional sayings and slogans) on top should you still eat it?

We were give discrimination for a reason, to protect us from garbage beliefs.  When are you going to use your discrimination and stop trusting in delusional humans.?

wrote on Nov 19^th, 2009 at 12:30pm:

Quote: Semantics of scientific terms is a dodge of the questions. I can't talk to you about calculus unless I know you have a firm understanding of arithmetic. [quote]I thought we were discussing evolution not genetics.  Genetics does not support evolution.

Evolution is claimed to be the gradual change of living things correct? Which get their shape and function via genetics correct?

It's like you want to talk about swimming the English channel but discussing water is waaay off-topic.


Quote:

If you think that changes in the DNA from one generation to the next is your definition of evolution then it does not fit the "real" definition.

I've never claimed any such thing. I've just been trying to keep things simple and to the point and nice and slow, so we can forge mutual understanding.

I want to put together a list of Axioms that we can agree on. Build this list longer and longer until we reach one we can't agree on. And then we'll talk about it.
[/quote]

This is exactly the methodology of indoctrination and cults.

Axioms with no foundation become your "slogans of deception" that are founded on human garbage and not real objective use of the scientific method.
This is how you got brainwashed into dysfunctional beliefs. This is the same crap you use on other children and pass this abuse of science on down.

I do not ever accept any logical fallacy and I never accept any form of belief that is contrary to the laws of physics.

How can anyone not understand that.  You cannot bend laws and say you are a scientist.

wrote on Nov 25^th, 2009 at 10:58am:

"A law differs from a scientific theory in that it does not posit a mechanism or explanation of phenomena: it is merely a distillation of the results of repeated observation." Universal Gravitation is a law (despite the strangeness of singularities AND that we haven't gone to other galaxies to see if the gravitational constant is the same). Our understanding of the mechanism of Evolution is a theory. It attempts explain the physical reality of evolution. You redefine scientific concepts to fit your arguments. Mutation for example. Mutation has no intrinsic value judgment. You swear up and down that mutations are "FREAKS" but it's just a change. This redefinition you keep doing weakens your position because it demonstrates misunderstandings of science.

You got it backwards. You religious fanatics have taken foundational scientific terms and bastardized them to fit a disgusting mystical magical religious belief. 

There is no magic in science and using the method of changing facts is called fraud.

;D ;D


wrote on Nov 18^th, 2009 at 7:34am:

Quote: You cannot talk about DNA and not include traits YES you can. Traits only emerge from DNA that is EXPRESSED. Most organisms have far more DNA that is actually used. There are long stretches of non-coding "junk" DNA that does not get used. This DNA mutates too. [quote]There can only be "traits" and information passed from parent to offspring. There is no other possibility.  This is well known in genetics.

As I said. The parent passes DNA, that is often slightly changed.


Quote:

The ability of creatures to make changes to survive as the same creature is pretty obvious.

Same creature??? You just said earlier that no two individuals have the same DNA (except for twins maybe). So how can you call them the "same" creature.
They are very similar. If they are similar enough they can potentially produce viable offspring. This is how we define species.


Quote:

What is thought to be random "mutations" are neither random nor are they mutations. They are manifestation of the programming in the DNA and environmental adjustments, that can be retro or can come and go as the need of the organism changes.

So you're saying DNA copying errors are planned? What protein steps in at the right time to fudge up the copying process. NONE. This is not the case. DNA copy errors just happen (along with all of the other mechanisms of mutation).


Quote:

There are no accidents or random "mutations" because random is not even a scientific possibility in the physical world.  There are only causes and effects in the real world.

I also have a feeling that there is no true randomness. It is clear to me that nothing escapes causality. BUT! BUT! The universe is so fantastically complex we see all sorts of phenomena that are, for all intents and purposes, random. Snowflakes all show structure and yet all are unique. They assemble according to the rules of physics and chemistry but still, they're all different, all essentially random.
Mutations are the same way. We can't know why or when DNA will mutate. It could be caused by a high-energy photon from a star 100 light years away, or it could be from a copy error. These things happen and even though they still obey physics, they engine is essentially random.

AXIOM: Changes to DNA occur "randomly" (both of us agreeing the idea of random in the physical world doesn't make sense, but the level of complexity makes the events we see essentially random).


Quote:

Magical thinking is not part of real science.  This is one of my axioms which I prefer to call "absolute truths of science".

You use the word "absolute" quite often. "Absolute truth", "absolute evidence". It's interesting because it opens into the philosophical realm and that is not useful to us. I don't know that we can know anything to be "absolutely true". You'd always have to leave open the possibility you're being deceived by an evil genius with the means and the motive. I don't think this is the case but I don't go stomping around talking about absolutes.

[/quote]

So Now you accept magical mystical causes?  Wow, do you ever think about what you are saying?
Who taught you out of the ability to see bovine garbage, could it be that these people indoctrinated you pretty good so that you don't even realize there is an absolute truth on any event, happening, physical phenomenon, chemical reaction. Every thing that happens in life has an absolute truth as to what really happened.
Using mystical and magical reasons is a religions belief.  This is an absolute truth. It is not science! This is an absolute truth.
It amazes me when people stop seeking the truth and only seek to perpetuate beliefs.  But that is what 99.9% of the people in science seem to do. This is because this ability to want the truth is superseded with mystical garbage belief in "theory is the highest truth in science".
What happened to that objective logic you were born with? Maybe it was never in your genetic make up to begin with.
;D ;D

wrote on Nov 19^th, 2009 at 3:18pm:

Is this all just hilarious satire? If so you're a genius! I honestly can't tell if you're pulling my leg now.

"The first thing they do when you present the truth is denial for no reason. The next is they fight you. Then it becomes accepted."

You need to be able to listen.  You need to learn from me if you want to be free of nonsense beliefs.

wrote on Nov 20^th, 2009 at 1:03pm:

Quote: I know more about biology than you do Yeah. Your descriptions of genetics and mutation illustrate this perfectly.. LOL...  ;D [quote]Evodelusionism (my term for your religion.)

Oh here's a new word. I certainly haven't seen it in ANY posts you've made hear. Totally new. Wow, insightful..

Funny how you call this a "Neutral Evolution Forum" and then you already believe evolution is a delusion.
[/quote]

You are perfectly welcome to bring any absolute evidence that shows you are not a nut case religious fanatic.  But so far all you have is logical fallacies and evidence that conflicts with the laws of physics. 

Try another angle, because there for absolute damn sure is no evidence for it in DNA.

GoodScienceForYou wrote on Nov 28^th, 2009 at 5:49pm:

wrote on Nov 20th, 2009 at 1:03pm: Quote: I know more about biology than you do Yeah. Your descriptions of genetics and mutation illustrate this perfectly.. LOL...  ;D [quote]Evodelusionism (my term for your religion.) Oh here's a new word. I certainly haven't seen it in ANY posts you've made hear. Totally new. Wow, insightful.. Funny how you call this a "Neutral Evolution Forum" and then you already believe evolution is a delusion.

You are perfectly welcome to bring any absolute evidence that shows you are not a nut case religious fanatic.  But so far all you have is logical fallacies and evidence that conflicts with the laws of physics. 

Try another angle, because there for absolute damn sure is no evidence for it in DNA.
[/quote]

It is the Neutral Evolution Forum, because I am neutralizing it into nothing, rapidly.   ;D ;D ;D ;D

wrote on Nov 19^th, 2009 at 1:44pm:

I don't mean to insult, but you're just being frustratingly obtuse. I still don't know what you do and don't know about genetics and cell biology. So we're ill-equipped to talk about anything more complex than that.

I work with physics, mechanical and electrical engineering, thermodynamics and solar electric.  These are based on functional science.

I study genetics and cell biology and evolution from a huge distance, because early on I saw the delusion crap in it.  Since in the 40 years since I started looking into it, there has been no evidence for evolution but a lot of evidence against it, it is not doing very well. 
In the class room they use "slogans" that have never been tested by any scientific method.  I find that disgusting.
They have bastardized most of the genetic terms to fit this absolutely unproven nonsense.  I thought you had some actual physical evidence that was clear and had no belief in it.  I am sorry that I expected more from you, but you are typical and have no news for me.
You are attempting to make something that needs to be simple, into some complex system of bovine garbage.



wrote on Nov 19^th, 2009 at 1:44pm:

Children inherit DNA and cell machinery, NOT traits. [./quote] This is unsubstantiated crap.  "Children do not inherit traits." Where the hell did you get your degree? Was it the mail order PHD's I get in my email?  You send in $20 and get a certificate.   ::) wrote on Nov 19th, 2009 at 1:44pm: Mutation is a fact. DNA mutates. However, scientist don't have a clue what the cause of these changes are and it is not a "mutation" unless you are an idiot, and there is no such thing a random in the universe!The universe runs on stable laws of science, but it appears that you don't have a clue about any laws of science. wrote on Nov 19th, 2009 at 1:44pm: DNA determines organization. You cannot have any structure or organization if the DNA has random changes.  The universe operates on structure and the laws of science, which you seem to avoid. wrote on Nov 19th, 2009 at 1:44pm: It's logical that if DNA can change then the organization can change. The only place where any information can come from is passed down from the parents. Unless you are a nut case, and believe in fantasy magical, mystical causes.  There is no random in the universe because of the laws of physics.  Any BS that avoids the laws of physics is NOT science but is human garbage belief and basically that is mythological religion. [quote author=424C4C5976405D765A404459454C290 link=1258492863/25#25 date=1258663475] I see that you believe in "adaptation", but from what I've read it's for the wrong reason. You seem to think that organisms have a built-in area of leeway in which they can fluctuate a bit, but that's totally wrong. So we need to get it cleared up. So, without proselytizing , can you  quote the parts you don't agree with and we can get on with discussion?

Adaptation is a fact. We know this is real.  We can see this in the DNA as the genome responds to the environment. It is designed to survive not some human emotional mental garbage of evoldelusion.
Is that clear.  You have no evidence of this Evodelusionism.

wrote on Nov 17^th, 2009 at 4:59pm:

creatures changing their DNA over some immense time into entirely new creatures.  That IS the question. Once again you're skipping far far ahead. How can we discuss such things without a collection of mutually shared axioms. It's like discussing mathematics and you have different symbols for all of the operations and you're using a base 15 number system. We can't get anywhere like this. You're really pushing the edge of my patience. Now do you want to work on building a set of axioms or are we done here?

I find it disgusting that you would think this.

I teach people to not be as stupid and gullible as you.

If someone is taking you for a ride, and the put a blindfold over your eyes, don't you think it is far better to find out what is at the end of the road FIRST
???  I don't know how or understand how anyone could be so stupid as your to accept this crap. But apparently you are just the gullible dumb ass stupid dip feculence who would be so stupid as to wear the indoctrination blind fold and believe this feculence.

How is it plausible for people to be free thinkers if all they do is parrot popular beliefs.  This has been going on for as long as people can communicate. The children want to conform, so they lose their identity in what the "norm" is.

Children are not allowed the opportunity to think for themselves.  Indoctrination with ideas that have no basis in reality is common in societies.

In this case the young children will attack those who don't conform and tell them they are stupid for not believing in this nonsense of evolution.  The do this because the examples are set and kids can be pretty vicious emotionally to those who do not conform. 

But when you come across someone who is in their 50's and does this juvinile nonsense, you know that they minds are ridged and so they are stupid by allowing this crap to control their thinking for so long. 

There is absolutely no way a sane person could believe that fish came out of water with the intention to become a lizard.
This is total mythological bovine garbage.

That is funny, and sad at the same time.  These clowns are out there professing to be free thinkers, when all they do is parrot idiotic concepts and present their agendas.  They never have any real evidence and only cite other people's beliefs and religious Evodelusionism slogans that are not scientific concepts at all. The are totally unproven religious slogans.

The only agenda a true teacher has is to un teach you from delusional things.  To help you to back off on your ridiculous beliefs.

When you attach yourself to a belief system (BS) you can un-attach yourself from it just as easily, but your ego, pride and the need to conform and go along with the popular religious beliefs of the times, Evodelusionism, is very strong.

These people have closed minds and because of that are stupid and stunted in their intellectual development.