Could you explain, very briefly (bullet points would be perfect) the scientific method.

What constitutes the scientific method and how do I determine if a given study adheres to it.

I ask because I find thousands of articles on the peer reviewed literature which is, unless I got things woefully wrong, the final part of the scientific method applied to a paper. You said there are no articles about evolution that have followed the scientific method, so I'd like to know step by step what it is.

Note, I don't want to be told what evodelusionsists think the scientific method is. I don't want to be told evolution is a religion, I can read that in 50 other threads here. I just want to know what the scientific method is, in your own words, typed out here.

wrote on Nov 24^th, 2009 at 1:19pm:

Could you explain, very briefly (bullet points would be perfect) the scientific method. What constitutes the scientific method and how do I determine if a given study adheres to it. I ask because I find thousands of articles on the peer reviewed literature which is, unless I got things woefully wrong, the final part of the scientific method applied to a paper. You said there are no articles about evolution that have followed the scientific method, so I'd like to know step by step what it is. Note, I don't want to be told what evodelusionsists think the scientific method is. I don't want to be told evolution is a religion, I can read that in 50 other threads here. I just want to know what the scientific method is, in your own words, typed out here.

(Update: Nov 30 2009;  Inglorious is what is known in the message forum world as a troll.  He misrepresents himself in order to play stupid games.  He is a 100% member of the Evodelusion cult and trying as hard as he can to find fault in my writings.  Basically, he represents the levels of "ethically challenged" behavior that comes from being brainwashed into beliefs that have no foundation in science. His actions are sociopathic, with no regard nor respect for anyone. You can see that I believed him in the beginning.  I trust people until it is clear they are lying to me.  If he will lie about this, then you can't believe anything he says.)


Thanks for coming by, but this is the Neutral Evolution forum and we don't tell others how to answer, because that is not science.  We listen and learn. Telling others how to answer is not even polite. Requesting of people that you want evidence and not opinion is different. That is the scientific inquiry.

The question is do you really want to know and are you willing to listen and find the reality of science? (update: The answer was no before we even got started,because Inglorious is a troll.)

I learned this over 47 years ago, and it has not changed ever in real science. Any alteration is a bastardization of science because the people in the academia with mythological (Evodelusionism) religious agendas, are trying to keep their HEMG mental programmed silly jobs and have the "world is flat syndrome" deep in their brain.

The scientific method as it has been for over 200 + years is based on testing ideas to see if they are real.

---You start with an observation of a physical observed phenomenon that you can actually see, and pose a question about what it is? (Normally you break it down into only one premise at a time. This creates focus on the single phenomenon. Any time the "scientists" injects a lot of ideas at one time, ti is not using the real scientific method. Focus only on one thing at a time.)

(Since you cannot observe evolution happening, and when this was posed as a theory, it was and still is not even a natural phenomenon, but is a religious belief. There is no way to see evolution happening in creatures, except by belief.)

--The question becomes the hypothesis (or a series of hypotheses) as to why. Then that becomes the "premise" you are testing to understand the causes and effects of it in the natural world.

--You put the premise in the center of the circle and attack it from ever possible plausibility.  You imagine what would be the cause and test from as many angles as you can think of.  You NEVER impose your belief on science and eliminate any plausibility that would limit the scientific method (as is done today in Evodelusionism). You cannot define what is science, except that mystical, magical, metaphysics is not used.  Objectivity is the absolute necessity in a scientist and no beliefs projected on the evidence nor opinions from those beliefs are allowed.  Only when the data shows the possibility of and absolute trend do you make observations and conclusions with NO mystical, unfounded  beliefs allowed.  Listen to these videos in order.

http://www.youtube.com/watch?v=bQrkBtnD_UQ

http://www.youtube.com/watch?v=ZeAzlfNrqKM





Implications, inferences and projection of belief is not scientific. This is never allowed. Opinions are not evidence.




--Then you start to think on all the ways possible to test this phenomenon in real physical scientific experiments as it congeals into a theory.

You cannot simply look at some artifact and make determinations all by yourself. You must have a form of physical, testing that is objective, obvious, empirical and has no opinions nor belief in it as to the cause.  This absolutely requires DNA testing on fossils. (This eliminates the pseudo science of paleontology on most fossils, by the way. They have not used any scientific testing on replacement fossils, because there is nothing left in the specimen to test.)

--If you have any test that is successful, you start testing more and more; the same test over and over and over and if it shows the same results; good.  If you get many more tests that suggest this may eventually develop into a scientific fact and on to a scientific law, you proceed to test and test.  You share you scientific data and have an "open" forum amongst all scientists and have them do the same "physical testing".  You never impose unscientific, magical or religious belief on any evidence. 

--When all the testing by ALL possibilities that human beings can think of, has the same results with the same experiments and there is never any contrary result nor any ambiguous inferences (from belief), you can then use this as a science fact. You only go with what is shown in evidence and has no way to be manipulated by conjecture. Conjecture on evidence is the same as opinions. There is no such thing as "expert opinion" in science, if you want to avoid all HEMG from the system.

--If there is nothing that negates this it can become a theory of science after thousands of experiments, not before.  (One time that it fails and when tested that way it always fails then your idea is not proven.) (Idiots have theories, when they have no testing at all.) After many years of no different results on millions of experiments it becomes law. Then it is at the highest level of scientific "truth", never before. A theory is not a scientific truth, never has never will be.

--Falsification is not included in the scientific method. It has never been a part of it.  We only seek the truth and nothing else on any natural event on this earth.  This is true science. This is because you cannot falsify something that can never be tested as in the Theory of Evolution which is a metaphysical religious belief that can't be tested by any physical methods.

If you find any other nonsense, called the scientific method, it is not allowed here. Here we only go with the classic and well known scientific methods and we do not allow any opinions or mystical, metaphysical answers that have no evidence at all, (like evolution/creation has), in science here.


If it can't be tested, or there is no "tools" available to see the cause,  then it is thrown out and we start with a new project or a new way of testing when the tools are available.  No assumptions are allowed in real science, only what is empirically tested millions of times can be considered to be real.

Axioms of science can only be based on real evidence and it must be self evident with no opinions.

You cannot just look at something, declare that you are an expert, and call that science.  Understand? This is done now and they abuse the term scientist with this nonsense HEMG.

This is why the theory of evolution is not science. 

Genetics and DNA study is. I have never found a single thread of evidence for any evolution in DNA or Chromosomes or observed speciation.  There is only a natural change in the creatures to survive as the same species in evidence and then extinction when the requirements for life of that particular genetic structure can no longer survive.  That is all the evidence there is in all the papers I have read on this subject.

I really despise any religion in science.  It retards any progress towards the truth. :exclamation [smiley=thumbdown.gif] [smiley=2vrolijk_08.gif]

If your religion is true then it would be able to stand up to real scientific investigation.  There is only one truth, not two or three.

Ahh ok. I think I see it, though I confess it throws up a lot of other questions.

In particular you mentioned something about causes, we must be able to see the cause. How do we apply this to something like gravity. I know we have the law of gravity, but as far as I can tell all it explains is the idea that two masses attract one another. We can't see a cause for this, we just see that it happens.

wrote on Nov 24^th, 2009 at 2:50pm:

Ahh ok. I think I see it, though I confess it throws up a lot of other questions. In particular you mentioned something about causes, we must be able to see the cause. How do we apply this to something like gravity. I know we have the law of gravity, but as far as I can tell all it explains is the idea that two masses attract one another. We can't see a cause for this, we just see that it happens.

If you test gravity over and over and over and it always give the same results, under the same exact conditions, it is law. If you find that when you take it out of the conditions and it does something different under those conditions but still has the same results millions of times it is also a law under those conditions.

You cannot always see the cause, because the tools we have are so crude, so you never project what you think you see.

At the basic foundation of science are principles that can be used over and over, like a gift of nature, but humans lack the ability to determine the cause, because you cannot go any deeper than these foundations of science.  They are root and can't ever be explained. These are the foundation of all science.


Evolution as it is presented has obvious roots that could be explained and tested, if we had a time machine. It is not testable at this moment. There is no scientific method possible to test it. Therefor it is not science.

There is a law of truth.  For ever event that took place there is an exact truth how it occurred.  If you have no way to test what the truth was, you have to stop until you have the tools that actually can be proven to work. 

You have to also prove the tools. In evodelusion the dating methods are only assumptions and nothing else. Paleontology is only an assumption of belief and nothing else. It should not be in science at all. No scientific methods can be used in that science that are repeatable or verifiable by any other science.

Gravity is in the here and now and is fully testable by the scientific method.

Evolution is in the deep past and can't be tested at all. There is no way to make evolution take place, even in the last 50 million years the fossils remain almost exactly the same morphology.

I can test gravity all day long and it is the basis of chemistry. Without gravity there is no chemistry.  Don't you know that.  If you keep going all sciences will be discarded by your beliefs.

The question you can ponder that goes into the metaphysical and NOT science, is where did those foundational principles, the absolute archetypes of science come from?  Gravity, polarity, mass, momentum, magnetism, energy, etc.  No human can answer that from the perspective of being a human.  Science does not have hardly any answers at all, if you were to really analyze how much we know against how much there is to know we are pretty stupid.

Humans are frail weak creatures with nasty natures to hate one another over their various religions, races and politics and even pseudo science now is the same. In other words they can barely wipe there asses and most children are taught to put faith in these messed up authorities.

The truth comes and is after you get rid of all human emotional mental garbage beliefs.

Ask all the questions you want.  You are the first to pose any real science questions so far on here.

Ok, lets move it to evolution since I suppose that is the reason for this forum, but ignore the past because we don't have a time machine.

I saw in another thread where you were arguing with ex_chump (I think it was ex_chump) talking about mutations.  So, we can't know what mutations happened in the past because we don't have a time machine. That's fine, I can agree with that. But what about mutations that are happening now?

I read a comment in one of the other threads, from Squack I think, that all humans get 100 mutations in their DNA from their parents.

Wouldn't that too be a scientific law? We don't know why it happens, but just like gravity we see it over and over again. Even if we don't understand how it happens, we can see it happening?

Don't get me wrong, I'm not saying this is evidence that we evolved from monkeys, but it does seem to fit the criteria you provided for a law, ie something that we can test over and over again?

Or have I misunderstood?

wrote on Nov 24^th, 2009 at 3:22pm:

Ok, lets move it to evolution since I suppose that is the reason for this forum, but ignore the past because we don't have a time machine. I saw in another thread where you were arguing with ex_chump (I think it was ex_chump) talking about mutations.  So, we can't know what mutations happened in the past because we don't have a time machine. That's fine, I can agree with that. But what about mutations that are happening now? I read a comment in one of the other threads, from Squack I think, that all humans get 100 mutations in their DNA from their parents. Wouldn't that too be a scientific law? We don't know why it happens, but just like gravity we see it over and over again. Even if we don't understand how it happens, we can see it happening? Don't get me wrong, I'm not saying this is evidence that we evolved from monkeys, but it does seem to fit the criteria you provided for a law, ie something that we can test over and over again? Or have I misunderstood?

First you have to define "mutations" to you so you know what it really means and what that is vs what they think they see in the genome DNA.


Mutation is a foundational scientific term that also goes back hundreds of years with an established definition in genetics.  It does not need to be bastardized and have the meaning changed for no reason.  It disgusts me when they use flim flam and change the meanings of words when there is ABSOLUTELY no reason to.  Mutation is a phenomenon that is well recorded in medical and in scientific journals and it only refers to a genetic screw up on the number of chromosomes that causes and out of balance an deformed creatures or deformed chromosomes.  These mutations don't make it into main stream of the genus are always ill in some way and need a lot of help to survive if the make it at all past birth.  I have read many papers on this.

With the advent of DNA these fools try all they can to force belief on DNA and took Mutation to mean "difference in the DNA" It is not a mutation at all by the established meaning.

Do offspring automatically have hump backs, tails, and have brain deformities?  AS is the real definition of mutation?

It is a horrible abortion of science to destroy foundational scientific terminology that has been well established and make a mockery of science as they do in the name of this religion.

In the DNA of the offspring, the DNA shown can only come from the parents.  There is no other way it can appear.
Do you understand that?

Start there.

Ok, so mutation is the wrong word for it. I have to give it a name so I can refer to it. Let me name it after I describe what I think it is.

So we have the DNA of the Mum and Dad, and it gets passed onto the offspring. 23 chromosomes from Mum, 23 from Dad. These chromosomes are made up of genes, which in turn are made up of base pairs.

My understanding is that the child gets the 46 chromosomes, but that of the millions of base pairs contained within, 100 or so are different to those found in the parents.  You could say that the old base pair is substituted for a new one at those 100 places.

Hmm, actually that might be a good name for it,  substitution.

Now, we have no idea why this happens, but I don't think that matters does it? As with gravity, we don't know the cause, but if we can observe the base pairs being substituted by testing the DNA of children and parents then can we form a law on it.

I always thought this must be how DNA testing worked in law cases, because if new base pairs never arose wouldn't everybodies DNA be just about the same? Just different cobinations of the same 26 Chromosomes?

wrote on Nov 24^th, 2009 at 3:47pm:

Ok, so mutation is the wrong word for it. I have to give it a name so I can refer to it. Let me name it after I describe what I think it is. So we have the DNA of the Mum and Dad, and it gets passed onto the offspring. 23 chromosomes from Mum, 23 from Dad. These chromosomes are made up of genes, which in turn are made up of base pairs. My understanding is that the child gets the 46 chromosomes, but that of the millions of base pairs contained within, 100 or so are different to those found in the parents.  You could say that the old base pair is substituted for a new one at those 100 places. Hmm, actually that might be a good name for it,  substitution. Now, we have no idea why this happens, but I don't think that matters does it? As with gravity, we don't know the cause, but if we can observe the base pairs being substituted by testing the DNA of children and parents then can we form a law on it. I always thought this must be how DNA testing worked in law cases, because if new base pairs never arose wouldn't everybodies DNA be just about the same? Just different cobinations of the same 26 Chromosomes?

You are finally asking good questions.

These 100 or so apparently different DNA coding can only come from the genetics and all information is  passed from the parents.  There is no other cause that can even be construed,because random is not a term you could ever use in genetics.
If even one base pair can cause serious life threatening disease, then 100 screwed up random base pairs would mean immediate death.

The children of humans are always unique and amazingly different but they never (if they are healthy) are any other creature, but human.

If these are "random mutations" as these pseudo scientists call them (those who project belief of Evodelusionism on the DNA), then human life would not go on.  You must be able to see this, because it is obvious.  If life is as shown in the DNA is random then it is "fluid" and has no genetic stability. This equals death and no life.

The opposite is true: "The only thing shown in DNA is genetic stability."  The only thing in speciation is genetic stability. The only thing shown in the fossil record is genetic stability. This is from empirical evidence that cannot be refuted. It is in all the Evodelusionist papers, by the way.

If you "randomly" mess with one DNA pair you can cause devastating results, like the sickle cell anemia and or totally malfunctioning cells.   This would in turn doom humanity to extinction and a fast one at that.  Random is a disastrous word in genetic structural coding.  There is no random in the physical world ever. It is not a scientific term that should ever be used.  I have performed thousands of hours of testing, writing computer programs and there is no random,only in pure abstract (having nothing to tie it to the physical) mathematics.

There is no random, there is only a cause contained in the reproductive process. There is nothing else.

We can speculate all day long, but I know for sure there is no random changes in the DNA.  They have a cause. The effect is demonstrated in the DNA, but not the cause. That is deeper than we can see at the present time.

Science law;  Nothing can ever be the cause of itself even if the cause is not apparent.  So, DNA is not the cause of DNA but a result.  The cause of this changed DNA is not apparent and you should never invoke religious fantasy ideas on science.

In the baby, these could be just the appearance of some ancient coding from many ancestors back, laying dormant for many hundreds or thousands of years.  But they can only come from the parents passed on to the child.

If the mother is on drugs this can cause genetic destructive effects on the child. But this again is not a random event. It is caused.  When her child with this drug induced birth defect has children they may carry the messed up DNA and pass it on.

This is not random but has cause and effect.

The changes in the DNA is evidence, but does not establish a law unless the changes are always the same and never vary from parent to offspring in the result shown in ALL  the DNA of all the test subjects.

Oh clearly they are never going to be anything other than human, but I'm not sure I follow everything you wrote.

Like I say, correct me if I'm wrong, I only have a laymans understanding.

You mention that the genetics can only come from the parents. I agree, but what about these 100 changed base pairs? It must be the case that everybody has slightly different DNA because we all look different ,other than identical twins of course. Wouldn't that mean that not all substitutions are fatal?  I'm thinking in terms of little stuff, like say couldn't a substitution of a particular base pair change eye or hair colour, or even just give me a bit bigger nose than my Dad?

I've been trying to read up on this stuff and it looks like base pairs are made up of four different proteins. I forget the names, but the proteins are given the letters A T G C I think to represent them.

The idea seems to be that substituting a C for a G, say, might not be fatal, but rather as often as not does nothing. The new DNA still works. As long as the function of the gene in which the substitution takes place isn't massivly effected the gene carries on working.

That's kind of how I remember it from school, because I remember we used to talk about dominant and recessive alleles. The teacher said that alleles were different versions of the same gene, so the idea seems to be that changing a base pair, although it might be fatal, isn't always fatal. I remember that bit because the example she gave was about blue eyes, all the people in class with blue eyes apparently had received two recessive genes because blue eye colour is recessive.

The idea that I have is that the DNA of your parents obviously works, because your parents are both alive. When the child is born they get a working copy of DNA (from the parents) with a few minor modifications.
As long as those minor modifications to the DNA (the substituted base pairs) don't do something really bad like give you cancer or something then the new DNA is another working version.

I thought it was this substitution that allowed DNA testing to work for the police, since it distinguishes the DNA of everybody from everybody else.

My training was mostly in maths so I can discuss this type of stuff from a maths footing and state things a bit more technically. Lets say there are 1 million base pairs in our DNA. I know that's not right, but lets go with it.

We have 4 different possibilities for each place in the DNA, so the number of possible DNA sequences would be 4^1000000 (4 to the power of 1 million, a lot of possibilities).

Now, the majority of these combinations are fatal, no life can exist. But some of the combinations are able to support life. Everybody alive is an example of a working order of DNA, most of these will be very similar to each other.

We could call all possible DNA combinations the DNA space (the space of all possible combinations). Lets use the eye colour example from above. Now, we know that the DNA for an eye is very complicated. But, I mentioned allels, so we know that there are at least a couple of changes that can be made to eye DNA and it still works as an eye, albeit a different colour eye.

We would say that these two sequences are very close together in DNA space. The jump from one to the other is very small.

Now this is how I think substitution works. Your parents have working DNA, both lying close to each other in DNA space. When you get your DNA, although it is not identical (due to the 100 mutations) your DNA is still very close to theirs in DNA space because it is based on theirs. It wasn't possible to jump very far, since you only got 100 mutations out of the 1 million base pairs. Because you couldn't jump very far, you might well have landed on another combination in DNA space that supports life. This follows on from the eye example, the best chance we have to find another working DNA combination is to start out very close in DNA space to a known working copy, ie parents. The childs DNA is very close to both parents, with just a few substitutions that don't effect it greatly and result in another working version in DNA space.

Wow, I just re-read that. I hope it makes sense. The maths does, but I tried to apply it to biology and DNA and I don't know enough about that so would like to know if it translates properly.

wrote on Nov 24^th, 2009 at 4:56pm:

Oh clearly they are never going to be anything other than human, but I'm not sure I follow everything you wrote. Like I say, correct me if I'm wrong, I only have a laymans understanding. You mention that the genetics can only come from the parents. I agree, but what about these 100 changed base pairs? It must be the case that everybody has slightly different DNA because we all look different ,other than identical twins of course. Wouldn't that mean that not all substitutions are fatal?  I'm thinking in terms of little stuff, like say couldn't a substitution of a particular base pair change eye or hair colour, or even just give me a bit bigger nose than my Dad?

This idea of random mutation is part of the belief that has no foundational scientific testing to support it. There is not a single paper with any evidence nor testing by the scientific method.  Go read all you can on this and tell me where the scientific method is used to back up this assertion based on evolution belief? It does not exist, because there is no test for this.  It is not even logical at all. Random DNA changes spells death to the creature. Then extinction altogether.

The only place these DNA changed can come from is the parents. There is no other possibility.  Genetic stability is all that is shown. They make the assumption that what they can now perceive is all there is. They are actually looking at results and thinking they have "causes".



wrote on Nov 24^th, 2009 at 4:56pm:

I've been trying to read up on this stuff and it looks like base pairs are made up of four different proteins. I forget the names, but the proteins are given the letters A T G C I think to represent them. The idea seems to be that substituting a C for a G, say, might not be fatal, but rather as often as not does nothing. The new DNA still works. As long as the function of the gene in which the substitution takes place isn't massivly effected the gene carries on working.

(Troll notes: Here this troll, Inglorious, tries to pass as a "layman", but it is obvious he is brainwashed and deceptive.  The DNA does not have "A T G C I". Isn't he just so HEMG clever? People who think they are smart and pull crap like this are to be avoided and many of these forum "Nazis" do this crap. It is called "seeding the forum".)


The conclusions are not based on any evidence nor testing. It is only based upon the belief in what they think they are seeing.  Conclusions based on pre-belief and no evidence to back it,  as to what they want to see, is not science.  I go by what is actually there and what surrounds this, like the real world of creatures and the evidence we see there. All of it must fit perfectly or it is not real.  Their assumptions about DNA do not even remotely fit all of the evidence. And most all of the "evidence" for evolution is not evidence (not science) at all but belief in what they were brainwashed into thinking. They are not objective if they are believers. Belief destroys a scientist immediately. Belief in fairy tale mystical, mythological creatures that have never existed is on of their favorite fantasies.

Genetic instability is a disaster to any creature. If you hit the sperm with radiation and cause it to really mutate you get creatures that have never been able to make it in the real world. They die. The sperm dies or if it actually can inseminate the cells are messed up.  Only a stability in the genome is actually shown.  These differences can only come from the parents.


wrote on Nov 24^th, 2009 at 4:56pm:

That's kind of how I remember it from school, because I remember we used to talk about dominant and recessive alleles. The teacher said that alleles were different versions of the same gene, so the idea seems to be that changing a base pair, although it might be fatal, isn't always fatal. I remember that bit because the example she gave was about blue eyes, all the people in class with blue eyes apparently had received two recessive genes because blue eye colour is recessive.

(This guy is such a friggin troll.)
The change in the base pair from the parent comes from the parent.  That is why it is a natural change and not some genetic mutant freak or just comes out dead all the time. 

Dominant and recessive genes is the actual terminology before this crap got into science.

They have no idea what is going on, yet they speak.  All you are hearing is a belief with no evidence to back it.  Seeing the results are not harmful of the changes is not evidence.  If the changes in the DNA is harmful and it comes from the parents, they would not know where it comes from until they have a complete DNA analysis of all the ancestors up and until they find the ancestor with that messed up DNA.  They have never done this on any large level of testing and for the purpose of finding where this genetic feature really came from. They are blind as to any of this, because they only believe in Evodelusionism and don't want to find out.



wrote on Nov 24^th, 2009 at 4:56pm:

The idea that I have is that the DNA of your parents obviously works, because your parents are both alive. When the child is born they get a working copy of DNA (from the parents) with a few minor modifications. As long as those minor modifications to the DNA (the substituted base pairs) don't do something really bad like give you cancer or something then the new DNA is another working version.

The new DNA is not new, if you can find it in any ancestor. But they never look for these traits in the ancestors to find out how they arrived in the offspring.
I have seen many great grand children who look like their great grand parents, the spitting image.  Those looks are genetic in nature.  There is only genetic information and traits passed down, not any magic in real science.

There is no mysticism nor magic in real science.



wrote on Nov 24^th, 2009 at 4:56pm:

I thought it was this substitution that allowed DNA testing to work for the police, since it distinguishes the DNA of everybody from everybody else. My training was mostly in maths so I can discuss this type of stuff from a maths footing and state things a bit more technically. Lets say there are 1 million base pairs in our DNA. I know that's not right, but lets go with it. We have 4 different possibilities for each place in the DNA, so the number of possible DNA sequences would be 4^1000000 (4 to the power of 1 million, a lot of possibilities). Now, the majority of these combinations are fatal, no life can exist. But some of the combinations are able to support life. Everybody alive is an example of a working order of DNA, most of these will be very similar to each other. We could call all possible DNA combinations the DNA space (the space of all possible combinations). Lets use the eye colour example from above. Now, we know that the DNA for an eye is very complicated. But, I mentioned allels, so we know that there are at least a couple of changes that can be made to eye DNA and it still works as an eye, albeit a different colour eye. We would say that these two sequences are very close together in DNA space. The jump from one to the other is very small.

I am sorry but mathematics does not work in genetics. Really. Every time they try it fails because their is no random in the physical world.  It is an apparent chaos that is not chaos at all.

If you go these scientist would go back a few 8 or so generations and check the DNA in all the ancestors, I would be anything you will find the exact traits that are missing from the current parents but are in the child are in some ancestor. There can only be genetics passed down and that has to have a cause. There is no random in the DNA.

There is no random in the physical world.
These pseudo scientist will never go back on any real scientific method and check the DNA of the ancestors until they find this exact patter in some ancestor.  It would destroy their belief in "Evodelusionism" and no government funding would help them either to find the truth if they proposed it as an experiment to destroy the theory of evolution by real facts. They would not get any grant money for seeking the truth.


wrote on Nov 24^th, 2009 at 4:56pm:

Now this is how I think substitution works. Your parents have working DNA, both lying close to each other in DNA space. When you get your DNA, although it is not identical (due to the 100 mutations) your DNA is still very close to theirs in DNA space because it is based on theirs. It wasn't possible to jump very far, since you only got 100 mutations out of the 1 million base pairs. Because you couldn't jump very far, you might well have landed on another combination in DNA space that supports life. This follows on from the eye example, the best chance we have to find another working DNA combination is to start out very close in DNA space to a known working copy, ie parents. The childs DNA is very close to both parents, with just a few substitutions that don't effect it greatly and result in another working version in DNA space.

There are 3.2 Billion base pairs in the human genome.

And even though you have only a hundred or so that are different than both parents. Those 100 interact with 3.199 billion base pairs to form 319 billion different combinations of cell constructs that are all integrated in the human child.
This is why there is so much difference in the children. 100 base pairs alone is nothing, it is the interaction of the completed RNA processes that build these cell systems that interact throughout the body that create the huge differences in the children.  This is obvious by all of the evidence we have. There is no such thing as a disintegrated life form.  Each part interacts to support the whole organic structures and assemblies.


wrote on Nov 24^th, 2009 at 4:56pm:

Wow, I just re-read that. I hope it makes sense. The maths does, but I tried to apply it to biology and DNA and I don't know enough about that so would like to know if it translates properly.

When you get a fantasy told to you, it is up to you to realize what is going on.  Nobody has the right to inflict their beliefs on you.  It is up to you to stay clear of all beliefs until it is proven to you absolutely.
That includes anything I tell you.  When you read my stuff, go check it out.  When you read Evodelusion stuff, you will find nothing but the projection of the idea of evolution and no evidence for it.  There is no evidence for evolution. It does not exist.

There is ONLY evidence for genetic stability. There is evidence for adaptation to the environment, but only to a point. Once the species can no longer adapt as that species they go extinct. There is no trail of evolution on this planet.  It does not exist in physical evidence. These are irrefutable facts shown in evidence.
There can only be genetic answers to any species.  There is no evolution shown anywhere.

The theory of evolution is base upon mystical events and magical processes that have never been shown to be in any evidence.

If a gene was present in an ancestor, but not in a parent, how would it get inherited by a child?

The childs DNA is made up of a combination of it's parents DNA plus these 100 or so substituted base pairs. These 100 or so base pair differences were not in the parents DNA, so where were they stored in order to be passed on?

As you say, there must be some causal mechanism. Clearly the information isn't stored in the parents DNA, so where is it stored?

wrote on Nov 24^th, 2009 at 7:39pm:

If a gene was present in an ancestor, but not in a parent, how would it get inherited by a child? The childs DNA is made up of a combination of it's parents DNA plus these 100 or so substituted base pairs. These 100 or so base pair differences were not in the parents DNA, so where were they stored in order to be passed on? As you say, there must be some causal mechanism. Clearly the information isn't stored in the parents DNA, so where is it stored?

Excellent question!  You are very intelligent.

The answer is in the coding that is causal. What you see in DNA is an effect or result of the causes.  The absolute causes of this DNA replication is not seen by these people so they think they are at the end of the line. This has been seen over and over as new technology reveals itself.
DNA is not the cause of DNA, because nothing in the physical universe can be the cause of itself.  This is a scientific law.

There is so much they don't know about this phenomenon.

Because this offers them a chance to project their dumb beliefs on this DNA they call it "random mutations" and express their false authority as scientists, which is based on nothing but a HEMG belief and a need to keep that belief going.

If you were to go back in the genealogy of any human you will find and exact same set of DNA coding that matches what is seen in the down line of the genealogy in the present generations.  They will never look for this, because it ruins their religious beliefs.

At some point in the future, this will become obvious. This crap religion will eventually get purged from genetics.

Anyone who believes in evolution has no credibility with me, because so far it has no evidence to substantiate any of it.


This can only be true, not some mystical magical "random" without any causes.  These low IQ people cannot face any facts nor can they do anything that would ruin the religion. 

There is no random, so random is not a possibility.  Do you understand? There is only cause and effect in the natural world of science.  Random = death and extinction.

Nothing can appear on this earth without cause.  No magic is allowed in science. DNA cannot be the cause of itself.

There can ONLY be information transferred to the offspring, what is in the DNA is not all of it, but only what can be seen now.  This is obvious because these traits are not shown in the "effect" or results of the traits in the DNA shown in the parents, but they are "exposed" or revealed  in the child.

This is standard genetics that has been around for nearly a century. Before this mystical crap religion of projecting fantasy on all the evidence, we knew this. 

It was apparent in all the relatives we could see from the current offspring.
Now that they have a new level of understanding with DNA, they are dumb enough to think that is the end of the line. This is like how we found germs (bacteria and virus) the first time and thought that was the end of the line.

We will have to wait to see the extremely complex cause of this simple DNA replication that is supposed to be the end all of genetics. 

Now they want to mess with this, when they have not a clue what it is. That is typical of arrogance and ignorance combined.

Documented example of "DNA changes".

They're talking about changes, they use the word mutation.
http://www.springerlink.com/content/j48183p575111t47/

The gene NF1 "changed" at codon 1947 from C to T.

That means the parent, in exon 31, had (gatgccaaacgacaaagagtt) and the child had (gatgccaaatgacaaagagtt).

Repeat, the child has a DNA sequence not present in the parent.

Repeat, the child has a DNA sequence not present in the parent. So for a while, a single cell existed in the parent with this DNA change, then that cell along with another cell became the child. So the child has the change and the parent does it.

This is the sort of change Inglorious is talking about.

Right there, black and white. Let's hear you deny it and tell me my brain is broken and stuff.

wrote on Nov 24^th, 2009 at 10:11pm:

Documented example of "DNA changes". They're talking about changes, they use the word mutation. http://www.springerlink.com/content/j48183p575111t47/ The gene NF1 "changed" at codon 1947 from C to T. That means the parent, in exon 31, had (gatgccaaacgacaaagagtt) and the child had (gatgccaaatgacaaagagtt). Repeat, the child has a DNA sequence not present in the parent. Repeat, the child has a DNA sequence not present in the parent. So for a while, a single cell existed in the parent with this DNA change, then that cell along with another cell became the child. So the child has the change and the parent does it. This is the sort of change Inglorious is talking about. Right there, black and white. Let's hear you deny it and tell me my brain is broken and stuff.

This shows only a change, not the cause. That is where you put your religious belief and screw up the evidence with crap pseudo science.

There is no random in the physical world.  Repeat that truth until you get it.

There is only a cause that can only come passed through the parents.  There can never be any random in any creature.  This would destroy the species.  You cannot have genetics that is random.  If it is random,then it is fluid and not stable.  There is nothing but genetic stability shown in the real world of fossils, DNA, and in all of genetics. This is an axiom of truth that you cannot falsify.

If you have not stable DNA or genetics you have no creature. It goes rapidly extinct. It is either stable or it goes extinct quickly. There is no gray on this axiom.

You do not understand the cause, because it is not apparent to you.  Just like when you try to use a magnifying glass to look at bacteria, you can't see the cause of the disease, until you have the tools to see it.  IN the same way until you see the cause you are ignorant to it.

Quote:

There is no random in the physical world.  Repeat that truth until you get it. There is only a cause that can only come passed through the parents.  There can never be any random in any creature.  This would destroy the species.  You cannot have genetics that is random.  If it is random,then it is fluid and instable.  There is nothing but genetic stability shown in the real world of fossils, DNA, and in all of genetics. If you have instable DNA or genetics you have no creature. It goes rapidly extinct. You do not understand the cause, because it is not apparent to you.  Just like when you try to use a magnifing glass to look at bacteria, you can't see the cause of the disease, until you have the tools to see it.  IN the same way until you see the cause you are ignorant to it.

None of this ^^^^^ has anything to do with the evidence. The substitution happened. For whatever reason it happened.

And now the child is slightly different. This is called descent with modification.

wrote on Nov 24^th, 2009 at 10:23pm:

Quote: There is no random in the physical world.  Repeat that truth until you get it. There is only a cause that can only come passed through the parents.  There can never be any random in any creature.  This would destroy the species.  You cannot have genetics that is random.  If it is random,then it is fluid and instable.  There is nothing but genetic stability shown in the real world of fossils, DNA, and in all of genetics. If you have instable DNA or genetics you have no creature. It goes rapidly extinct. You do not understand the cause, because it is not apparent to you.  Just like when you try to use a magnifing glass to look at bacteria, you can't see the cause of the disease, until you have the tools to see it.  IN the same way until you see the cause you are ignorant to it. None of this ^^^^^ has anything to do with the evidence. The substitution happened. For whatever reason it happened. And now the child is slightly different. This is called descent with modification.

There is no modification if this is found in the genealogy of the offspring and the parents.  You would never look for this because of your HEMG beliefs.
Go read my answer to Inglorious and wake up.

Quote:

There is no modification if this is found in the genealogy of the offspring and the parents.

I just told you, the parent had one sequence and the child has a modified sequence. Descent with modification.

You're never going to admit this are you? Here is the evidence. Plain as day and you're going to just close you eyes and plug your ears. That figures.

wrote on Nov 24^th, 2009 at 10:29pm:

Quote: There is no modification if this is found in the genealogy of the offspring and the parents. I just told you, the parent had one sequence and the child has a modified sequence. Descent with modification. You're never going to admit this are you? Here is the evidence. Plain as day and you're going to just close you eyes and plug your ears. That figures.

We can see the change, but we have no idea why, and it is for sure not based on some magical bovine garbage of random changes to the DNA.  You can keep you mystical ideas to yourself.

You cannot make assumptions based on nothing but your religious beliefs as you always do.  You need to get clear of this magical crap belief.  It is ruining your credibility.

You make assumptions and conclusions based on nothing but a projection of religious belief, and you think you are correct?  WTF is the matter with your brain?

You keep giving me opportunities to attack your fundamentalist religious mythological beliefs, so you are going to have them attacked.  If you have no possible clear and obvious evidence or even were to use any science that is real, it would be different.
There is no science in your delusions. 
I am a real scientist and only go with what is absolutely clear and contained in the evidence and in the laws of science. If you continue to violate the laws of science then you are a delusional fool.

You cannot violate the laws of science and make up magical religious crap.
There is no decent with modification if you can't prove modification has taken place.  Is that clear? 

In order to prove modification from any ancestor has taken place you have to have the DNA from the ancestors to test.
In the future this will all go away as the cause of this change will be revealed.  There are no random events or genetic causes. There is only cause and effect. 
You do not know the cause, so you fill in the blanks with your delusional mystical religious bovine garbage.

There is no "random mutation" in the genome. This would destroy the species. Is that clear? There is only genetic stability and adaptations to the environment. Is that clear?
This is all that has been shown in all the evidence you have available from all your papers on genetics. It is revealed in all the speciation papers as well.

There can only be cause and effect in the real world. There is no fu#king magic in science.  It only follows what is presented in the real world of logic and reason.  If it has no possible logic but relies on magical, religious fundamentalist mythological ideas, then it is religious bovine garbage.

You present logical fallacies all the time, so far.  Can you get with the program and become a real scientist?

I am not going to always be patient with people who are unwilling to learn what science really is.  You cannot use your mystical answers any more.  Stop it! :D ;D [smiley=thumbsup.gif] [smiley=rolleyes.gif]

You do not seem to have the capacity to see that you are just a religious fundamentalist who believes in fairy tales of mystical creatures that have no evidence of ever existing.
You are extremely delusional and it comes from the religious brainwashing you have been victimized by.

http://www.youtube.com/watch?v=BC1qruCbFIA

I don't think you really answered my question. I asked where the information is stored, and you said that it is "the coding that is causal".

What does that mean? It looks like an assertion rather than absolute evidence. Can you point me to the evidence, rather than an "it's obvious"? Your post says that it has been seen "over and over", so presumably it is documented somewhere that I can go and read.

ex_chump pretty much summed up my problem with this.

If the parent has the sequence aaacg and the offspring has the sequence aaatg, then the offspring has a different combination.

Now, you say that this new sequence, aaatg, is not new, but rather would be found in an ancestor. Well, as you have demanded "absolute evidence", can you provide "absolute evidence" that this sequence has been seen in the past?

Quote:

We can see the change, but we have no idea why, and it is for sure not based on some magical bovine garbage of random changes to the DNA.  You can keep you mystical ideas to yourself

.

DNA copy errors are known to occur. They're not magical, they're a result of a process that is susceptible to perturbation. I gave you any example for one. Why they happen doesn't matter. They happen, at a fairly stable rate. In fact, evolution counts on them as the source of new functionality.

Handwaving and sidestepping and calling this magic isn't argument. I posted a published scientific document and you have refused to acknowledge it let alone argue against it.

I want you to type.. "Ok, fine! descent with modification has been empirically documented and i acknowledge this as absolute proof of its existence." OR explain why this isn't proof of that. Good luck.

wrote on Nov 25^th, 2009 at 6:06am:

Quote: We can see the change, but we have no idea why, and it is for sure not based on some magical bovine garbage of random changes to the DNA.  You can keep you mystical ideas to yourself . DNA copy errors are known to occur. They're not magical, they're a result of a process that is susceptible to perturbation. I gave you any example for one. Why they happen doesn't matter. They happen, at a fairly stable rate. In fact, evolution counts on them as the source of new functionality. Handwaving and sidestepping and calling this magic isn't argument. I posted a published scientific document and you have refused to acknowledge it let alone argue against it. I want you to type.. "Ok, fine! descent with modification has been empirically documented and i acknowledge this as absolute proof of its existence." OR explain why this isn't proof of that. Good luck.

You avoid reality like it was some sort of plague.  That is because you are brainwashed and do not have a single original thought.  You are no different than anyone who has surrendered logic and reason for a meal ticket.

wrote on Nov 25^th, 2009 at 5:35am:

I don't think you really answered my question. I asked where the information is stored, and you said that it is "the coding that is causal". What does that mean? It looks like an assertion rather than absolute evidence. Can you point me to the evidence, rather than an "it's obvious"? Your post says that it has been seen "over and over", so presumably it is documented somewhere that I can go and read. ex_chump pretty much summed up my problem with this. If the parent has the sequence aaacg and the offspring has the sequence aaatg, then the offspring has a different combination. Now, you say that this new sequence, aaatg, is not new, but rather would be found in an ancestor. Well, as you have demanded "absolute evidence", can you provide "absolute evidence" that this sequence has been seen in the past?

One more time.  There is a law of science that states there is no random in the physical world. Random does not exist.

The way things happen are cause and effect, even when you can't see it.

We know from genetics that THE only source of genetic information can come from the parents. This has been known forever and was only messed with when this delusional idea of evolution was infecting science.

There is no other place to get information from. 

So, if there is no such thing as random and the only source for the information in the genome of the child is from the parents, it is only natural that any changes from the parents 'exposed' DNA is from what you cannot see as the cause.

It is very obvious and clear.

Your life and the truth is worth far more than some need to belong to something that makes you feel important.

The weak neediness of humans make them want to believe something that gives life meaning, even if it is a total lie.

There is no need to believe in bovine garbage, when that is all you have.  You need to set your sites higher, towards what is true.  If you seek the truth, you will find it.  If you seek to perpetuate belief, then that is all you have.

"You do something someone else's way, you take your life into your own hands."  Dirty Harry (really)

"The purpose of enforced conformity is control.  They make examples out of those who don't conform and
they own you this way."

"The keepers, guardians of their fake "truth" are vigilant and always angry when their belief are attacked with the truth."

If you don't understand this video then you are not ready to face the truth.  The truth does set you free.

http://www.youtube.com/watch?v=bQrkBtnD_UQ

You keep referring to "the laws of science" and "this has been known for ages".

Can you provide citations of the science literature please. All I have thus far is your assertion that these things exist. Since you are the one is contantly telling me not simply to believe what others tell me, can you back it up with a citation from the science literature?

wrote on Nov 26^th, 2009 at 2:05am:

You keep referring to "the laws of science" and "this has been known for ages". Can you provide citations of the science literature please. All I have thus far is your assertion that these things exist. Since you are the one is contantly telling me not simply to believe what others tell me, can you back it up with a citation from the science literature?

You know that I am going to make you look like an idiot.
Why do you fools insist on being humiliated in order to understand real science?

How can you ask such a dumb question? Don't you know that the whole "theory of evolution" is based on this idea of cause and effect?  How lost are you.  Either the white dear in the snow survives or the brown dear in the snow survives.
Are you really that lost, or are you just gullible and have weakness of character?  That is a question you need to ask yourself.

In physics we have a very basic law that runs all physical interaction.   It is the law of cause and effect.
If you don't know this you are not a scientist. It is the first thing one learns in physics because ALL OF physics depends on it and it never fails!

"For every action there is an equal and opposite reaction."

In the physical universe all matter and energy follows this law. The next law that destroys random is this one:

"Energy cannot be created or destroyed. It can only be transformed." 

When someone using a pile of garbage logic that does not fit what is actually happening in the entire world of physical phenomenon, covered by those two laws, you know they are really screwed up mentally.  The only thing that causes this sort of delusional bovine garbage is religious beliefs that are fantasy and what is called "magical thinking".



That last blithering idiot, living in denial of reality, left like a screaming angry bitch, because that is what a person is who lays down like a bitch dog to ever dumb ass authority.

Are you ready to learn or are you going to be one of those screaming bitches whom I have to destroy in order to teach them a lesson.

GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

wrote on Nov 26th, 2009 at 2:05am: You keep referring to "the laws of science" and "this has been known for ages". Can you provide citations of the science literature please. All I have thus far is your assertion that these things exist. Since you are the one is contantly telling me not simply to believe what others tell me, can you back it up with a citation from the science literature?

GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

Don't you know that the whole "theory of evolution" is based on this idea of cause and effect?

Yes.


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

Either the white dear in the snow survives or the brown dear in the snow survives.

Exactly. That would be a selection pressure, the one best suited to the environment has the best chance of survival and thus the best chance of passing on its genes.


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

In physics we have a very basic law that runs all physical interaction. It is the law of cause and effect.

You refer to the idea that the Universe is deterministic, a position that is yet to be demonstrated, but which I happen to agree with. I don't say it's proven, because it isn't. In particular there are various aspects of quantum mechanics that are not well enough understood, virtual particles spring to mind immediately. The copenhagen interpreation (she shroedingers cat) and probability wave functions are not certainly not well enough understood to declare them to be deterministic. The dual slit experiment is probably the easiest way to observe this.


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

If you don't know this you are not a scientist. It is the first thing one learns in physics because ALL OF physics depends on it and it never fails!

Go tell it to the quantum physicists. I never claimed to be a scientist, but I do have qualifications in physics. Most of my formal training, as I started previously, was in maths.

You are yet to define what a scientist is. I defined it the other day, I suggested a scientist is one who has a paper published in a recognised journal that has been cited. Can you claim to have one, or are you not a scientist either?


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

"For every action there is an equal and opposite reaction."

You do realise that this is one of Newtons laws of motion, right? You also realise that this law actually fails in certain circumstances? That is, it is only a law under controlled conditions, much as Newtons law of gravity is a special case of general relativity? Oooh look, I just showed two laws that don't always hold true :D


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

The next law that destroys random is this one: "Energy cannot be created or destroyed. It can only be transformed."

Ahh, now we are on with thermodynamics. No issues with this one. 


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

When someone using a pile of garbage logic that does not fit what is actually happening in the entire world of physical phenomenon, covered by those two laws, you know they are really screwed up mentally.

I would postulate that when someone suggests that laws are proven despite these laws only working under predetermined conditions they don't have a clue what they are talking about.


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

The only thing that causes this sort of delusional bovine garbage is religious beliefs that are fantasy and what is called "magical thinking".

Quite.



GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

That last blithering idiot, living in denial of reality, left like a screaming angry bitch, because that is what a person is who lays down like a bitch dog to ever dumb ass authority.

So presumably you will retract the statements that I have shown to be in error?


GoodScienceForYou wrote on Nov 26^th, 2009 at 12:24pm:

Are you ready to learn or are you going to be one of those screaming bitches whom I have to destroy in order to teach them a lesson.

Oh keep up the "destruction", its fun to pick holes in it.

If random is real, then nothing exists, but chaos and no order.

It really is a law that there is no random.  It is a logical fallacy that random exists. 

I don't believe in fairy tales and complicated bovine garbage filled with pages of logical fallacy.  If you do that is your problem.

If you believe in random then you are not a scientist but a religious nut case.

There is no magic in science. There are laws.

Because of this absolute law, there can be no "random mutations" in DNA.  It is utter religious "magical thinking" bovine garbage.  Utter nonsense and a lie.

IF they will lie to you about random, what else do they lie to you about. 

How about the bovine garbage that there is "synthetic carbon" used in making nylon.  That is a direct lie.

If you go through all of their evidence it  is all a lie with nothing to tie it together but a thread of utter religious human garbage beliefs.

I hate magical religious human mental garbage in science.  Yet it has always been there.

"He who joyfully marches to music in rank and file has already earned my contempt." Albert Einstein

"If the facts don't fit the theory, change the facts." Albert Einstein

"I personally am disgusted by anyone who would use utterly contrary crap religious belief that opposes the laws of science, and call themselves a scientist."  GoodScienceForYou

If you are one of those religious nut case "pseudo scientists" Evodelusionists, then you are not going to fair very well in any discussion on science facts with me.  I will destroy you in any debate.

And if random exists the entire idea of evolution in all its facets is completely destroyed. That is funny as hell.  Yet these dumb asses are not aware that they contradict themselves all the time. 

You cannot have random in DNA and no random in evolution theory.  Idiots are running this science.  If you can keep track of all the contradictions, which takes the ability to understand two simple things at one time, which is about a "room temperature" IQ level; you would never see evolution anywhere.

You cannot have two "truths" that are utterly contrary in science.  One is bovine garbage the other is true.  There is no gray in real science. 

In this case random is HEMG, and cause and effect is true.

wrote on Nov 26^th, 2009 at 12:53pm:

GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: wrote on Nov 26th, 2009 at 2:05am: You keep referring to "the laws of science" and "this has been known for ages". Can you provide citations of the science literature please. All I have thus far is your assertion that these things exist. Since you are the one is contantly telling me not simply to believe what others tell me, can you back it up with a citation from the science literature? GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: Don't you know that the whole "theory of evolution" is based on this idea of cause and effect? Yes. GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: Either the white dear in the snow survives or the brown dear in the snow survives. Exactly. That would be a selection pressure, the one best suited to the environment has the best chance of survival and thus the best chance of passing on its genes. GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: In physics we have a very basic law that runs all physical interaction. It is the law of cause and effect. You refer to the idea that the Universe is deterministic, a position that is yet to be demonstrated, but which I happen to agree with. I don't say it's proven, because it isn't. In particular there are various aspects of quantum mechanics that are not well enough understood, virtual particles spring to mind immediately. The copenhagen interpreation (she shroedingers cat) and probability wave functions are not certainly not well enough understood to declare them to be deterministic. The dual slit experiment is probably the easiest way to observe this. GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: If you don't know this you are not a scientist. It is the first thing one learns in physics because ALL OF physics depends on it and it never fails! Go tell it to the quantum physicists. I never claimed to be a scientist, but I do have qualifications in physics. Most of my formal training, as I started previously, was in maths. You are yet to define what a scientist is. I defined it the other day, I suggested a scientist is one who has a paper published in a recognised journal that has been cited. Can you claim to have one, or are you not a scientist either? GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: "For every action there is an equal and opposite reaction." You do realise that this is one of Newtons laws of motion, right? You also realise that this law actually fails in certain circumstances? That is, it is only a law under controlled conditions, much as Newtons law of gravity is a special case of general relativity? Oooh look, I just showed two laws that don't always hold true :D GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: The next law that destroys random is this one: "Energy cannot be created or destroyed. It can only be transformed." Ahh, now we are on with thermodynamics. No issues with this one.  GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: When someone using a pile of garbage logic that does not fit what is actually happening in the entire world of physical phenomenon, covered by those two laws, you know they are really screwed up mentally. I would postulate that when someone suggests that laws are proven despite these laws only working under predetermined conditions they don't have a clue what they are talking about. GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm:   The only thing that causes this sort of delusional bovine garbage is religious beliefs that are fantasy and what is called "magical thinking". Quite. GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: That last blithering idiot, living in denial of reality, left like a screaming angry bitch, because that is what a person is who lays down like a bitch dog to ever dumb ass authority. So presumably you will retract the statements that I have shown to be in error? GoodScienceForYou wrote on Nov 26th, 2009 at 12:24pm: Are you ready to learn or are you going to be one of those screaming bitches whom I have to destroy in order to teach them a lesson. Oh keep up the "destruction", its fun to pick holes in it.

I would say you are a moron if you don't know the absolute laws of science. They are obvious, always work and never fail.

If the laws never fail, why is it that I can point to specific examples where Newtons laws fail? I even mentioned it. It is simply a special case of what we now know, the knowledge given to us by Einstein. It is underpinned by classical mechanics which is a limiting case of general relativity (actually special relativity, but that itself is a special case of general relativity).

As for your continuous and laborious rants about random, do you even read my posts? What about the post I made where I said I didn't think true randomness existed?

I noted that I didn't think you had understood my reference to apparent randomness, this would seem to confirm it.

wrote on Nov 26^th, 2009 at 2:34pm:

If the laws never fail, why is it that I can point to specific examples where Newtons laws fail? I even mentioned it. It is simply a special case of what we now know, the knowledge given to us by Einstein. It is underpinned by classical mechanics which is a limiting case of general relativity (actually special relativity, but that itself is a special case of general relativity). As for your continuous and laborious rants about random, do you even read my posts? What about the post I made where I said I didn't think true randomness existed? I noted that I didn't think you had understood my reference to apparent randomness, this would seem to confirm it.

This guy's comments are as predictable as can be.  They always bring up this as a means to try and destroy the laws of gravity as it stands here on earth.  Under all conditions on earth it works the same way and without it on earth we would pretty much all die.  All the seeds, and food would float away the entire earths core would simply vanish into space.

Pay close attention.   When you perform the same test under the same conditions and you always get the same results it it law. 

If you take the test out side the parameters and change the parameters, you still get the same but different results under those conditions. It is still law.

Don't let stupid people take you down. 

You cannot impose religious beliefs in science, like forcing random in DNA and publishing your lies in a book,  when there is no random in the physical universe. Do you think it is OK to impose religious beliefs in fairy tale ideas on evidence.  .  These people are crappity smacking delusional.

I answered you post and you need to stop posting the same question over and over, because I will ban you for spamming the board.  If you can't read that is your problem.

You are not here to learn, obvoiusly, so I am going to have to ban you if you can't get with the rules.

I am not going to answer the same question on 10 different threads.  If you don't understand then you can't go on any farther in your education.  I don't want crappity smacking trolls on here.
I only want people who seek the truth and have crappity smacking brains that are not lost in conflicting garbage.

If you don't get it that there is no random in the universe then get the crappity smack out of my class.  I don't want any idiots asking the same utter nonsense over and over because they can't understand the laws of science.

You cannot have any part of science break the laws of science, no matter how much the crappity smacking politicians and corporations want this garbage.

wrote on Nov 26^th, 2009 at 2:34pm:

If the laws never fail, why is it that I can point to specific examples where Newtons laws fail? I even mentioned it. It is simply a special case of what we now know, the knowledge given to us by Einstein. It is underpinned by classical mechanics which is a limiting case of general relativity (actually special relativity, but that itself is a special case of general relativity). As for your continuous and laborious rants about random, do you even read my posts? What about the post I made where I said I didn't think true randomness existed? I noted that I didn't think you had understood my reference to apparent randomness, this would seem to confirm it.

This is your last post on this.  If you are too stupid to understand that a random in the universe means no universe, because without the fundamental laws of science that hold the universe together it doesn't exist.

There is only cause and effect, no random.  After the first impulse that generated this universe and all the laws of science were started that hold the universe together, it has never changed.  It is one action, event after another that is only cause and effect. 

When humans are too weak minded an feeble to see all the "events" taking place at at one instant, does not make them apparently random, but it shows clearly how weak and feeble the human mind is.

The whole study of the weak ass theory of quantum physics is based on this same dumb ass principle of how weak and stupid humans are that they can't understand all the trillions of events that take place at any instant that are based on the laws of science.  So in their weak attempts to find some way to understand what it going on they group things and they come up with extremely stupid ideas like random when they do that it then becomes and extremely unrefined and inaccurate use of math.   

When we have computer that can analyze billions of events in one instance quantum will be shown to be idiotic.

Because humans are so stupid the try to force ideas on the universe. Mostly because they are weak and fearful and have to make garbage up to answer questions their weak and feeble minds can't even comprehend.  Religion in science is caused by weak and stupid people who make up fantasy to answer things they have no way of knowing.

This fantasy of evodelusion requires the fantasy of random in some of its bovine garbage beliefs in order to have random DNA happen by magic.These fools then say that there is no random when it comes to other parts of their beliefs.

If they tell you one lie, and you figure it out, then it unravels pretty easily as you go study all the evidence they don't show you and how there are upright humans living some 6.1 million years ago with a modern femur.  You won't find that evidence in any classroom, because I have asked an not one student is aware of this.  This is because radiometric dating on replacement fossils is a total fraud.

Now we have them violating the laws of physics and saying that these new DNA in the offspring must be "random mutations" when there is no such thing in the entire universe.  There are many more logical fallacies that this bovine garbage belief is imposed on evidence.  Only a person who is brainwashed into belief would allow this garbage in science.

You have to realize it makes me sick to have to deal with really stupid people for too long.  Getting into that level of ignorance and trying to pull people out means that I have to go in and understand all of your sick delusions and see the conditions you are in.  To me it is like a doctor going to a village of people with cholera and having no way to fix them, because the disease is too deep.  You have to fix yourself.

I can only tell you the truth about science from an entirely objective perspective of no beliefs. I only go with what is in the evidence and what is obvious and what follows the laws of science that have never failed to be true in my 47 years of science study.

When I was 16 years old I realize immediately that these weak humans who are in charge of the fossils are delusional believers in bovine garbage and were projecting that belief on the fossils and ruining them as scientific specimens.

Belief destroys all credibility.  Knowledge of the truth is not believe.  As soon as you are brainwashed into a belief and you "absorb it" declare your allegiance to it by getting a degree in it or teaching this delusional bovine garbage, or just telling your friends you believe (Amen Darwin god of the universe)  to other people you are totally fu#ked in the head and have no credibility and no logic or reason left.  You life then becomes nothing but a fu#king fantasy that never seem to go anywhere and not many of the pieces seem to fit.

Only what is true produces good results.

How do you know if it is true science?  Look at the results.

http://www.youtube.com/watch?v=dUN0GPzGwnY




If you don't have the capacity to understand the laws of physics I strongly suggest that you find some other hobby.
If you do anything with science you will make mostly mistakes and be worthless to humanity as a scientist until you grasp the "rules" of life and science.

I am not going to wast any more time until you are ready to learn from me and stop being a troll, spamming this forum with your nonsense.

You can go read all the articles of the physicists on this. They will tell you that anyone of the fundamental laws of science  were to not function life would cease. 

There are many articles on this and you can google them.

Don't ask any more really dumb questions.

I am totally aware of all of Einsteins work.  He is one of my mentors.

There is no modification, without modification.
You cannot show where these  DNA coding come from, so with your dumb ass belief you say it is random.

Random in the physical world violates all the laws of physics.

You need to take physics classes and learn those laws.

If any "science" idea violates the absolute laws of physics then it is void and worthless.
There is no such thing as random in the physical world.  Only a really ignorant person could believe such a delusion.

Again, if ANYTHING in DNA is random, the species ceases to exist.  You know that just one screwed up point in the DNA can cause a very severe disease, then you know that DNA cannot ever be random.  Random DNA changes and over 100 of them would kill. 

What sort of geneticist are you that you don't know this?
It is sad to see such ignorance. :'(

GoodScienceForYou wrote on Nov 27^th, 2009 at 2:00am:

snip... Random in the physical world violates all the laws of physics. You need to take physics classes and learn those laws. If any "science" idea violates the absolute laws of physics then it is void and worthless. There is no such thing as random in the physical world.  Only a really ignorant person could believe such a delusion. snip...

Can you explain to me why Brownian Motion is NOT random and a well studied effect? I thought Einstein published a paper wherein he detailed the randomness of such. Have I been mislead?

:D Oh MY!  There is a cornucopia of retardation here!  PERFECT!

 

GoodScienceForYou wrote on Nov 27^th, 2009 at 2:00am:

There is no modification, without modification. You cannot show where these  DNA coding come from, so with your dumb ass belief you say it is random. Random in the physical world violates all the laws of physics. You need to take physics classes and learn those laws. If any "science" idea violates the absolute laws of physics then it is void and worthless. There is no such thing as random in the physical world.  Only a really ignorant person could believe such a delusion. Again, if ANYTHING in DNA is random, the species ceases to exist.  You know that just one screwed up point in the DNA can cause a very severe disease, then you know that DNA cannot ever be random.  Random DNA changes and over 100 of them would kill.  What sort of geneticist are you that you don't know this? It is sad to see such ignorance. :'(

WOW!  This is great, you really have no f**king idea of what your talking about do you!  I love it!
:)

dogsreamer1 wrote on Nov 30^th, 2009 at 4:22pm:

GoodScienceForYou wrote on Nov 27th, 2009 at 2:00am: snip... Random in the physical world violates all the laws of physics. You need to take physics classes and learn those laws. If any "science" idea violates the absolute laws of physics then it is void and worthless. There is no such thing as random in the physical world.  Only a really ignorant person could believe such a delusion. snip... Can you explain to me why Brownian Motion is NOT random and a well studied effect? I thought Einstein published a paper wherein he detailed the randomness of such. Have I been mislead?

The very definition of this is "seemingly random". Don't you know that.
People come up with all sorts of half baked ideas and run with it. I only go with what follows the exacting laws of physics.
You can never apply any form of the term apparent random to dissimilar quantum.  It does not work with any precision at all. I do not deal in gray but in what is actually happening.

In the genome of creature random means extinction, immediate extinction.  If one DNA pair being messed up can case severe disease then 100 is immediate death.

DNA is not the cause of DNA.  Nothing in existence is the cause of itself.  That is known as insanity and delusion to think that anything is the cause of itself.

If you can't see or envision the fact that there is no random, then I pity you.  This is absolutely obvious..

Prove that random is even a scientific principle.  It is used only on statistics as a way for weak people to try and group things in to trends.  Trends are not absolute facts.

When people are too weak minded and feeble to understand more than 10 things happening at one time, does not even infer that random exists.   They came up with this HEMG  of quantum totally out of weakness and feebleness of humans.  Anything that comes from human weakness is ridiculous. 

When you have all the same not living, mass that is exactly the same, then you can use this idea, but why? The only real quanta is a cloud of electrons, a mass of the same, like a glass of pure water, then you can use that in chemistry and physics.



It is because humans are feeble minded and weak that they can't discern billions upon billion of non random interactions they came up with this idea.

There can only be a cause and an effect or result.  There is no other possibility in real physics.  If you see any random in the genome then I would say you need help with your idea of reality.

There  in no random in the universe.  What you see as random is a sign of humans' feeble minded ideas.

Go read more Einstein writings.
;D ;D

http://galileoandeinstein.physics.virginia.edu/more_stuff/Applets/brownian/brownian.html

When you watch this, tell me exactly what this has in common with the idea of "random changes" to DNA? 

This shows a motion that reflects very well the physics concepts of:

"For every action there is an equal and opposite reaction."

"Nothing in the universe is the cause of itself."

You can easily see that each of the tiny dots are bumping into each other and as one bumps off it then is deflected by the point of contact in an equal and opposite reaction.
However, this has nothing, nada, zilch, zero in common with genetic structures in complex cells needed to sustain life.
;D

I asked, in what I felt was a honest manner;
Quote:

Can you explain to me why Brownian Motion is NOT random and a well studied effect? I thought Einstein published a paper wherein he detailed the randomness of such. Have I been mislead?

Then you responded with this:

Quote:

The very definition of this is "seemingly random". Don't you know that. People come up with all sorts of half baked ideas and run with it. I only go with what follows the exacting laws of physics. You can never apply any form of the term apparent random to dissimilar quantum.  It does not work with any precision at all. I do not deal in gray but in what is actually happening. In the genome of creature random means extinction, immediate extinction.  If one DNA pair being messed up can case severe disease then 100 is immediate death. DNA is not the cause of DNA.  Nothing in existence is the cause of itself.  That is known as insanity and delusion to think that anything is the cause of itself. If you can't see or envision the fact that there is no random, then I pity you.  This is absolutely obvious.. Prove that random is even a scientific principle.  It is used only on statistics as a way for weak people to try and group things in to trends.  Trends are not absolute facts. When people are too weak minded and feeble to understand more than 10 things happening at one time, does not even infer that random exists.   They came up with this HEMG  of quantum totally out of weakness and feebleness of humans.  Anything that comes from human weakness is ridiculous.  When you have all the same not living, mass that is exactly the same, then you can use this idea, but why? The only real quanta is a cloud of electrons, a mass of the same, like a glass of pure water, then you can use that in chemistry and physics. It is because humans are feeble minded and weak that they can't discern billions upon billion of non random interactions they came up with this idea. There can only be a cause and an effect or result.  There is no other possibility in real physics.  If you see any random in the genome then I would say you need help with your idea of reality. There  in no random in the universe.  What you see as random is a sign of humans' feeble minded ideas. Go read more Einstein writings. ;D ;D

Dude,

I don't think this forum is for me, as you obviously fail to follow your own user agreement. Perhaps you should just go ahead and banish me like all the others that challenge you. I did not show ANY disrespect towards you, but you sure have done so towards me. I just asked a simple question and you feel it is a good idea to rant on me like I ACCUSED YOU OF LYING! Is it normal for you to be so angry that you disrespect folks as a matter of course? I don't see how you have refuted the findings of Einstein, but rather covered up an opportunity to enlighten me by making snide remarks about human feebleness and DNA. I'll give you another chance to explain how Brownian Motion is not random, as your response doesn't even make grammatic sense to me.

I did not realize that science was about proving things. I was under the impression that accumulation of evidence was the prime directive of real science. Show me your proof, or one iota of supporting evidence, that randomness is not possible. Since no two snowflakes are identical it seems to me that some random factor must be at work. How is it that there is not? Is the path of an electron not random? Is not the appearance and destruction of virtual particles not random? Empty assertion, like your rant above, doesn't convince me. I'd like to see some peer reviewed work that denounces randomness. Failing such citations I cannot begin to take you seriously. Who, and why, should anyone do so?

If you have a "set" you should join a real forum wherein neutral moderation protects users from rants like yours. Try Richard Dawkins forum as an example of such. Of course you won't do that as this little playground of yours strokes your over inflated ego quite nicely, doesn't it?

If you see my post as angry, then go look in the mirror.  I am extremely enthusiastic about science and love the subject.
Unless you identify yourself I have no idea who you are. Which poster are you?  Your IP doesn't match anyone's.

I don't like people making a mockery out of science.

Random is an idea in people's minds that has never been proven,  and it rides in the totally unproven "Quantum Theory" which is not even close to a law.  Random is an excuse for the weak human mind that is not capable of seeing all the billions upon billions of interactions taking place at one time.  So they pile on this "nebulous fantasy" of random because they can't even envision that much "activity".  Your apparent random is nothing but huge masses of events taking place in time and space and always cause and effect.

When you impose a concept that has no way of being proven and tell me it is part of science, then I am going to point it out and mock any one who uses it as it if it was true.  If people use any mystical magical concepts and think they are real, then they are not scientists.

I work only on the side of "truthification".  If it has never been shown with absolute evidence then it is not science. If it "seems to work" in some obscure quantum that is not proof or even absolute evidence.

I want you show me all the compelling evidence that random in the genome does not cause death?  You simply cannot have a completely structure organism that is frail and requires very precise cell construction to be healthy and tell me that some random cell construction isn't going to kill it.

The problem is the belief in Evodelusionism that has infiltrated science and ruins all objective science because the student are never allowed to see anything but what the preacher tells them if they want a degree in this extremely HEMG polluted science. 

ALL of the premises of Evolution are nonsense and really stupid that anyone could even "suggest" that evolution is in any evidence.  This is obvious.

Just don't take it personally, just prove your science beyond all doubts then get back to me.
It is idiot to use assumptions base on extremely poor use of the scientific method and ACTUALLY use it. 

Making  decisions on medicines, and gene therapy based on unproven hypothesizes? That is not even sane. It is dangerous to do that.  If this science was proven, then why are there so many destructive drugs in "medicine"?  If people actually knew on the deepest level what they were doing, this would never happen and drugs would be tested for years and years before put on the market. 

Everything I have seen in the Genome of healthy humans is very precise. There is no such thing as random mutations. It is utter nonsense and that needs to be dropped as any sort of premise, until you can prove that random is a real scientific term.

It only works in abstract math.  Everything in the universe is cause and effect, and nothing is the cause of itself.
When you see all the base pairs in the genome know that it is a structure and precise thing, not some random confused pile of helter skelter information.

How could anyone ever think otherwise?  That is the question you need to ask. :question

Science is retarded with assumptions and slogans that have no objective evidence. ::)

"Apparently random" movements of molecules in a jar of gas, with all the same or extremely similar molecules has not one thing in common with some magical idea of "random mutations" in extremely complex organic structures.  That is just ridiculous gullible nonsense based on wishful thinking.

You tell me how random changes in the DNA would not cause extinction? Why don't you try changing 100 or your own DNA base pairs and see how long you live.  Would you bet your life on this unsubstantiated religious belief? ::)

"If you have a "set" you should join a real forum wherein neutral moderation protects users from rants like yours. Try Richard Dawkins forum as an example of such. Of course you won't do that as this little playground of yours strokes your over inflated ego quite nicely, doesn't it?"

I don't have much ego at all. Actually I think nothing of myself but to just be real and honest with people.  I can't be anything that I am not, and I would be dishonest if I tried.  It is not my fault that I was born this way, with this curse of intelligence.  Most of my life in my work I was the one who would go the mass of ideas and come up with what actually works. Because I am able to interpret science and use it.

I have nothing against anyone.  I just have a huge problem with projection of things that are not even close to plausible, and does not match the evidence at all.

Richard Dawkins is a fool?  Have you listened to his garbage religious rants?  He rips into people in public and tries to humiliate them because they think he is wrong.  He is arrogant and stupid, which is a bad combination.  He appeals to the weak and stupid people with his dumb ass slogans.  Other than that, he is just fine. [smiley=tekst-toppie.gif]

Why should any own show respect that fool.  All he has done is degrade science with religious nonsense.




When people come here and are trolls, meaning the lie to get the board seeded with garbage and try to use manipulation and nonsense to try and work "me" I do not tolerate deception on my forums.  I have had four forums that I ran and this is one of two that continue.

I don't have to be nice to deceptive liars and manipulators who's only purpose is to push their agenda and not to communicate at all. When they come on pretending to be something they are not, you know I will nail them.


When someone comes on the forum and starts the insults they will be banned, but they can expect to get the brunt of my disdain for them and I will expose how stupid they are for thinking they can fool me.  So, far they have all left like the cowards to face any reality in their religion.

If you want to know the truth, then you need to open your mind up to others. So, far not one Evodelusionist has ever done that with me.  That is friggin sad.  I read all of their links and posts out of respect, but they don't read mine and start with "Straw Man" arguments.

This is because they really believe that these PHD's actually understand science.  They trust the "guardians" of this religious magical mystical nonsense.

I have not much concern for what you think of me, because any "emotional" reasons are not compatible with me.  Emotional control issues is what you have.  You are way to concerned about not letting the truth hit you.  People think that trying to make me feel bad or some HEMG like;  not conforming to their beliefs?  If you are concerned with others opinions you will never find the truth, you will be adjusting the truth to other people's nonsense all the time so that you can feel warm fuzzies and get "appreciation" from the rest of the members of your church of Evodelusionism.

You must never let others control you with your emotions. You will never break out and be free.  Your freedom of thought action and purpose is being controlled by others.

Are you a socialist? Communist? Where did you get this idea that conforming is any friggin good for anyone?

Conforming to logical fallacies is really bad for you.  If anyone were to spend a week with me, they would learn to unscrew all that nonsense and start to wake up from their sleep. The truth in pure logic always wins.

GoodScienceForYou,
You are very confused about the concept of Random and the usage of the word random. This again is partly based on your ignorance of what Randomness is, and your equivocation relating to randomness to describe any action that for all intents and purposes in unpredictable and hence 'random' to the observer.
Signed,
   MarDuk

wrote on Dec 9^th, 2009 at 3:39pm:

GoodScienceForYou, You are very confused about the concept of Random and the usage of the word random. This again is partly based on your ignorance of what Randomness is, and your equivocation relating to randomness to describe any action that for all intents and purposes in unpredictable and hence 'random' to the observer. Signed,    MarDuk

You are the ignorant one.  There is no random in the universe. It is because people are so feeble minded that they came up with this crap.  Can you even concentrate on even 10 reactions taking place at one time?  Because you are not capable of seeing the billions of interactions going on at any one time, you think it is random.  It is not. There is only cause and effect in the universe.

You just don't get it do you? What is your problem? We've explained this countless times. There isn't just one definition of "random". You consistently revert back to this equivocation to support your position and it is a logical fallacy and totally dishonest to do so. Go to a street corner, make a log of the color of the cars that drive by. They're all behaving according to physics, but the order they pass you, to you, is RANDOM. Why don't you get this? It's simple. It's about perspective.

DNA copying errors occur RANDOMLY in the sense that the factors that contribute to them are chaotic. Not random in the sense of cause and effect, but random in the sense that they are difficult to predict. Get this through your skull sir. It is ridiculous that you don't acknowledge this.

wrote on Dec 10^th, 2009 at 8:15am:

You just don't get it do you? What is your problem? We've explained this countless times. There isn't just one definition of "random". You consistently revert back to this equivocation to support your position and it is a logical fallacy and totally dishonest to do so. Go to a street corner, make a log of the color of the cars that drive by. They're all behaving according to physics, but the order they pass you, to you, is RANDOM. Why don't you get this? It's simple. It's about perspective. DNA copying errors occur RANDOMLY in the sense that the factors that contribute to them are chaotic. Not random in the sense of cause and effect, but random in the sense that they are difficult to predict. Get this through your skull sir. It is ridiculous that you don't acknowledge this.

It is because of the weak and feeble human mind that they use random.  Most people can't chew gum and walk straight at the same time and they certainly are not going to be able to see all the interactions of energy and mass taking place at one time, so they make up crap and believe in it in order to not seem as stupid as they are.

Get it!  It is very simple and exacting.

Here is a quote (below) for you to contemplate. As soon as you give up on fantasy ideas the better for your mind.  Your intelligence actually will go up as people are not as stupid as the seem, they are brainwashed into ideas that have nothing to support them, except belief.  It is the nature of people to want to believe other humans.  It is an emotional problem for them.   You want to believe in cartoon creatures of mystical magical processes that are NOT real.

Science is not science without hard factual, objective and empirical evidence that is irrefutable.  If you don't have any of that to build on and all you have is "slogans" this is not science at all.

If you had this evidence, then I would believe you. I am sane, study this stuff at a distance, and never believe in logical fallacies.

"Two things are infinite: the universe and human stupidity; and I'm not sure about the the universe." Albert Einstein

He was talking about all humans, including himself. The more intelligence you have the more you realize how much you don't know.
You fools actually think that science is like a God, all knowing and all seeing, but it is composed of dumb ass people who live on assumptions, belief, and don't ever seek the truth.

You cannot be a real scientist if you believe in the religious concept of "random". This concept violates the laws of physics. There are only events and causes. There is no magical religious crap in science.  As soon as yo get that you will be on your way to being a free thinker an escape the tiny box of HEMG that you think is so real.

If you examine every car and every driver and their whole life of each of them, you will see that none of them are acting randomly.  They get up in the morning, get dressed and have a destination. That is not random.  All the events of the morning cause them to get on the road at precicely the time they did, and because of the conditions of their minds they drive the way they do, act the way they do.

There is no random in anything.  You have to be brainwashed out of pure logic and reason to "see" random when it has never existed on this planet as anything, but an idea.

Do you ever think on your own?  Do you just accept crap because some huge group of flawed humans tell it to you?

It is not that difficult to get free of this crap.

Way to ignore the point there.. lol.

wrote on Dec 10^th, 2009 at 10:33am:

Way to ignore the point there.. lol.

I am trying to help you out of this nonsense you believe in.  You cannot violate the laws of physics and call your belief, "science".
There is only ONE science and if your science violates the whole of science, then it is religion.

There are no magical causes in the universe. There are no mystical religious beliefs. The "magic" is in your head and not in the physical world.   
I really suggest you listen to me, for your own sake.  I don't teach for my sake.  I already know this stuff. 

If you want to do something worthwhile with science you have to break away from delusional beliefs.

No laws are being violated. I'm setting fire to that straw man. Give it up, it's a stupid argument.

Tell me, when a DNA copying error occurs, what "law" is violated?

wrote on Dec 10^th, 2009 at 10:46am:

No laws are being violated. I'm setting fire to that straw man. Give it up, it's a stupid argument. Tell me, when a DNA copying error occurs, what "law" is violated?

The law of defining things that are not errors by imposing belief on the evidence.

This idea of "errors" also comes from the idea of random causes.

Quote:

The law of defining things that are not errors by imposing belief on the evidence.

That's not a law and it's not happening.


Quote:

This idea of "errors" also comes from the idea of random causes.

Nevertheless DNA replication is an imperfect process. The new copy of DNA is not always exactly the same as the original. We call the differences ERRORS. It doesn't matter how they happen. And when they happen is as random the shapes of clouds or how many red cars drive by an hour.

In the genome of creatures random means extinction, immediate extinction.  If one DNA pair being messed up can cause severe disease then 100 is immediate death.

DNA is not the cause of DNA.  Nothing in existence is the cause of itself.  That is known as insanity and delusion to think that anything is the cause of itself.

When humans are too weak minded an feeble to see all the "events" taking place at at one instant, does not make them "apparently random", but it shows clearly how weak and feeble the human mind is.

GoodScienceForYou wrote on Dec 10^th, 2009 at 2:51pm:

In the genome of creatures random means extinction, immediate extinction.  If one DNA pair being messed up can cause severe disease then 100 is immediate death. DNA is not the cause of DNA.  Nothing in existence is the cause of itself.  That is known as insanity and delusion to think that anything is the cause of itself. When humans are too weak minded an feeble to see all the "events" taking place at at one instant, does not make them "apparently random", but it shows clearly how weak and feeble the human mind is.

Once change CAN cause death. When it does cause death then the population has nothing to worry about. That fetus gets miscarried. Evolution is about the accumulation of neutral and positive mutations. I know you deny they exist but we've posted tons of examples. So you're totally wrong.

Ho hum. You're repeating arguments that have been eviscerated. You're defeated.

wrote on Dec 10^th, 2009 at 3:17pm:

GoodScienceForYou wrote on Dec 10th, 2009 at 2:51pm: In the genome of creatures random means extinction, immediate extinction.  If one DNA pair being messed up can cause severe disease then 100 is immediate death. DNA is not the cause of DNA.  Nothing in existence is the cause of itself.  That is known as insanity and delusion to think that anything is the cause of itself. When humans are too weak minded an feeble to see all the "events" taking place at at one instant, does not make them "apparently random", but it shows clearly how weak and feeble the human mind is. Once change CAN cause death. When it does cause death then the population has nothing to worry about. That fetus gets miscarried. Evolution is about the accumulation of neutral and positive mutations. I know you deny they exist but we've posted tons of examples. So you're totally wrong. Ho hum. You're repeating arguments that have been eviscerated. You're defeated.

You are blinded by pride, ego, and ignorance of what real science is.  I suggest you go if you are not hear to learn from me or if you actually have some real evidence for me to look at.

Show me the absolute evidence. Anyone who believes things by inference, implication, and brainwashed beliefs is not a scientist.

Show me absolute evidence of any of your statements.

I have backed up all of mine with real science.

The problem is that you're not ready for evidence. You can't even get the basics right. What good is explaining anything to you if you don't have a grasp of the fundamentals.

That's been the problem all along. You want us to produce evidence for your strawman version of evolution.

The REAL evolution is waiting for you. And you deny it because you're stubborn and you don't want to hear it.

wrote on Dec 10^th, 2009 at 3:31pm:

The problem is that you're not ready for evidence. You can't even get the basics right. What good is explaining anything to you if you don't have a grasp of the fundamentals. That's been the problem all along. You want us to produce evidence for your strawman version of evolution. The REAL evolution is waiting for you. And you deny it because you're stubborn and you don't want to hear it.

You have not presented any evidence.  You don't understand the term. 

Here is a clue. Whenever you inject beliefs not based on ration, reason, logic, and have no foundation beyond your belief, it is not evidence.

Since there is no random in the laws of the universe, your premises in DNA is bovine garbage.

You need to bring evidence in to support your beliefs, and so far you are batting zero.

You do not realize that you have been brainwashed.  That is a hard one to overcome. If you want to be free, you must overcome that extreme limitation you imposed on yourself, by accepting HEMG authority over you mind.

Normally it is when people, kill someone by their beliefs that they wake up.  Many people in the army have woken up when they see their friends all blown to pieces.

People, who kill people in their work, because the do stupid things from that belief, will cause either depression, hospitalization or you wake the f up from your delusions.
The ones who cannot face themselves will never be free. They will die with all their delusions in control of their minds.

This is an excellent thread in which many of the belies are discussed and dismissed. Start at the top and read them all.

GoodScienceForYou wrote on Nov 24^th, 2009 at 2:24pm:

wrote on Nov 24th, 2009 at 1:19pm: Could you explain, very briefly (bullet points would be perfect) the scientific method. What constitutes the scientific method and how do I determine if a given study adheres to it. I ask because I find thousands of articles on the peer reviewed literature which is, unless I got things woefully wrong, the final part of the scientific method applied to a paper. You said there are no articles about evolution that have followed the scientific method, so I'd like to know step by step what it is. Note, I don't want to be told what evodelusionsists think the scientific method is. I don't want to be told evolution is a religion, I can read that in 50 other threads here. I just want to know what the scientific method is, in your own words, typed out here. (Update: Nov 30 2009;  Inglorious is what is known in the message forum world as a troll.  He misrepresents himself in order to play stupid games.  He is a 100% member of the Evodelusion cult and trying as hard as he can to find fault in my writings.  Basically, he represents the levels of "ethically challenged" behavior that comes from being brainwashed into beliefs that have no foundation in science. His actions are sociopathic, with no regard nor respect for anyone. You can see that I believed him in the beginning.  I trust people until it is clear they are lying to me.  If he will lie about this, then you can't believe anything he says.) Thanks for coming by, but this is the Neutral Evolution forum and we don't tell others how to answer, because that is not science.  We listen and learn. Telling others how to answer is not even polite. Requesting of people that you want evidence and not opinion is different. That is the scientific inquiry. The question is do you really want to know and are you willing to listen and find the reality of science? (update: The answer was no before we even got started,because Inglorious is a troll.) I learned this over 47 years ago, and it has not changed ever in real science. Any alteration is a bastardization of science because the people in the academia with mythological (Evodelusionism) religious agendas, are trying to keep their HEMG mental programmed silly jobs and have the "world is flat syndrome" deep in their brain. The scientific method as it has been for over 200 + years is based on testing ideas to see if they are real. ---You start with an observation of a physical observed phenomenon that you can actually see, and pose a question about what it is? (Normally you break it down into only one premise at a time. This creates focus on the single phenomenon. Any time the "scientists" injects a lot of ideas at one time, ti is not using the real scientific method. Focus only on one thing at a time.) (Since you cannot observe evolution happening, and when this was posed as a theory, it was and still is not even a natural phenomenon, but is a religious belief. There is no way to see evolution happening in creatures, except by belief.) --The question becomes the hypothesis (or a series of hypotheses) as to why. Then that becomes the "premise" you are testing to understand the causes and effects of it in the natural world. --You put the premise in the center of the circle and attack it from ever possible plausibility.  You imagine what would be the cause and test from as many angles as you can think of.  You NEVER impose your belief on science and eliminate any plausibility that would limit the scientific method (as is done today in Evodelusionism). You cannot define what is science, except that mystical, magical, metaphysics is not used.  Objectivity is the absolute necessity in a scientist and no beliefs projected on the evidence nor opinions from those beliefs are allowed.  Only when the data shows the possibility of and absolute trend do you make observations and conclusions with NO mystical, unfounded  beliefs allowed.  Listen to these videos in order. http://www.youtube.com/watch?v=bQrkBtnD_UQ http://www.youtube.com/watch?v=ZeAzlfNrqKM Implications, inferences and projection of belief is not scientific. This is never allowed. Opinions are not evidence. --Then you start to think on all the ways possible to test this phenomenon in real physical scientific experiments as it congeals into a theory. You cannot simply look at some artifact and make determinations all by yourself. You must have a form of physical, testing that is objective, obvious, empirical and has no opinions nor belief in it as to the cause.  This absolutely requires DNA testing on fossils. (This eliminates the pseudo science of paleontology on most fossils, by the way. They have not used any scientific testing on replacement fossils, because there is nothing left in the specimen to test.) --If you have any test that is successful, you start testing more and more; the same test over and over and over and if it shows the same results; good.  If you get many more tests that suggest this may eventually develop into a scientific fact and on to a scientific law, you proceed to test and test.  You share you scientific data and have an "open" forum amongst all scientists and have them do the same "physical testing".  You never impose unscientific, magical or religious belief on any evidence.  --When all the testing by ALL possibilities that human beings can think of, has the same results with the same experiments and there is never any contrary result nor any ambiguous inferences (from belief), you can then use this as a science fact. You only go with what is shown in evidence and has no way to be manipulated by conjecture. Conjecture on evidence is the same as opinions. There is no such thing as "expert opinion" in science, if you want to avoid all HEMG from the system. --If there is nothing that negates this it can become a theory of science after thousands of experiments, not before.  (One time that it fails and when tested that way it always fails then your idea is not proven.) (Idiots have theories, when they have no testing at all.) After many years of no different results on millions of experiments it becomes law. Then it is at the highest level of scientific "truth", never before. A theory is not a scientific truth, never has never will be. --Falsification is not included in the scientific method. It has never been a part of it.  We only seek the truth and nothing else on any natural event on this earth.  This is true science. This is because you cannot falsify something that can never be tested as in the Theory of Evolution which is a metaphysical religious belief that can't be tested by any physical methods. If you find any other nonsense, called the scientific method, it is not allowed here. Here we only go with the classic and well known scientific methods and we do not allow any opinions or mystical, metaphysical answers that have no evidence at all, (like evolution/creation has), in science here. If it can't be tested, or there is no "tools" available to see the cause,  then it is thrown out and we start with a new project or a new way of testing when the tools are available.  No assumptions are allowed in real science, only what is empirically tested millions of times can be considered to be real. Axioms of science can only be based on real evidence and it must be self evident with no opinions. You cannot just look at something, declare that you are an expert, and call that science.  Understand? This is done now and they abuse the term scientist with this nonsense HEMG. This is why the theory of evolution is not science.  Genetics and DNA study is. I have never found a single thread of evidence for any evolution in DNA or Chromosomes or observed speciation.  There is only a natural change in the creatures to survive as the same species in evidence and then extinction when the requirements for life of that particular genetic structure can no longer survive.  That is all the evidence there is in all the papers I have read on this subject. I really despise any religion in science.  It retards any progress towards the truth. :exclamation [smiley=thumbdown.gif] [smiley=2vrolijk_08.gif] If your religion is true then it would be able to stand up to real scientific investigation.  There is only one truth, not two or three.

This post is how real science is put into practice.