Are we going to have a decent discussion on this?
I am sick of me doing nothing but stating the facts and Evodelusionist going berserk. Can you remain on topic and can you actually read what I post. I give you the respect of reading all you post, you do the same. I don't want to ban anyone, I want an open discussion so we can all learn.
Quote: Quote:The "traits" of the offspring are contained in the DNA.
You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring. It cannot come from any place else. That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors. It can not come from random mutations.
Take a hypothetical gene.
In a parent, it looks like this:
atcgcaactctgaccagtactgcgacgtagtcatctgacggtacgtagcagctgagtcacag
And in a child, it might look like this
atcgcaactctgaccagtactgcgacgtagtcatc
agacggtacgtagcagctgagtcacag
You see the change? That's a mutation. It's a pretty simple idea. These have been documented. It is a germ-line mutation.. so that strand of DNA existed in the parent for a short while, but the changed gene isn't in the parents genome. So it didn't "come from" the parent.
And I don't know what you think gene expression is, but it has nothing to do with heredity in this sense. It's about the promotion of genes within cells and the RNA / Protein products they produce.
Quote:There are no transitional creatures in the fossil record
Every living thing is transitional.
"A guess is never an absolute truth."
You do not have a clue how the difference in the DNA of the offspring was established (how it was caused). That I know for absolute sure, in any creature bacteria prokaryotes, Eukaryota or human or dogs . This is because you do not know the cause and with your belief you try to make it fit your belief. You see the results and make up what you think it is from belief and very limited knowledge.
There can be no random in DNA. If it was random there would be no life. Noting can be different than the cause.
You would have to be a moron to believe in "random mutations". This violates the laws of physics.
Random means there is no genetic structure that supports life. Yet alll we have in evidence is supported by the laws of genetic stability and the transference of traits and information to the DNA. There are no magical, mystical events in real science. There can only be structure and science. The genome is the result of the genetic information that you can see. The cause you can't see. When you see something in the physical that appears it is only the result of a cause and is never random.
You are extremely stupid and you do what for a living. People trust a dumb ass like you to perform genetic science and you don't understand the fundamentals of physics??
What the hell are they teaching you? Do they tell you that it is OK to believe that you can violate the structure of the universe, and its laws?
If you can get away and back off on this belief that has no evidence then you can come into reality. When you don't know for crying out loud, admit it!!
There is no such thing as random in natural science, only in religious mystical bovine garbage that you believe.
Anything you can see in this universe is the result of a cause, and not random. When you look at DNA you see a result. You have no idea the cause of this different DNA in the human genome. If you say that DNA is causal it is because of your tiny weak little mind, projecting your messed up Evodelusion beliefs.
Here is what I think this different DNA is. It is an "expression" of traits that are below the level that you can see. There is no such thing as random in the physical world. Even your
high priests that go around fighting creationists for the cause of Evodelusionism state this. If you think there is random you are not a scientist. There is only logic and reason not fantasy and belief.
The only place where any construct of DNA or any information contained in the offspring can come from is the parents. There is no other way it can get there that any rational person would think or could think.
There is no magical mystical random mutation that takes place by accident. It follows logic that ancient DNA patterns can be evoked in the reproductive process. That these patterns are from pre-existing patterns and genetic coding that is the root cause of the DNA replication process in the parents (or any creature).You are just too stupid to understand this.
Because what I say is far more plausible than some random event, my hypothesis is far more rational, but is still just an extreme use of logic that has no beliefs in it. Beliefs destroy all credibility in a scientist as they are no longer objective when belief is first and foremost.
Scientists are supposed to follow the rules of science and not make up crap from delusional beliefs. What is real is right in front of your face, but you can't see it because of the human emotional mental garbage colored glasses you wear.
Jut like in the old days they had no idea that germs existed. Just like we had crude microscopes that could barely make out images of bacteria, and now we have the ability to see DNA constructs. Some day we will see even deeper and find the real cause of this apparent difference in the offspring.
Right now any belief projected on this is just ideas with NO evidence and only OPINIONS and that is all. It is crap pseudo science.
The results you see in the DNA are not the cause. Get it?
When someone projects opinions on evidence and thinks it is real they are not sane. That is why I never do it. I will tell you it is an opinion and only an opinion, but my opinion(s) makes a hell of a lot more sense than yours. Yours is tautology, indoctrination and group belief. Mine is from keeping clear of people's beliefs.
And keeping myself clear of beliefs until the evidence is HARD, has no opinions in it, obvious and absolutely clear and irrefutable.
My pure logical statements refutes any possibility of your belief as any more plausible than the tooth fairy.
Do you understand that when there is any other more plausible answer, it negates the belief? This is pure logic and reason with no belief. Most people are not capable of this level of objectivity I have found.
Projecting the idea of "random mutations" on something that is not random is you belief and projection of belief, based on nothing but belief, because there is no evidence to back it and it violates the laws of physics.
No scientist would ever violate the laws of physics. But for some reason you do. Could it be that you are brainwashed and ignorant of real science?
When something appears that you don't understand you force your belief on it, automatically. This is human nature; because humans cannot stand to not understand something so they come up with crap that fits their preexisting belief. (and it sounds so logical to brainwashed believers): Human nature is to fill in the blanks with belief and think it is real.
It is better to stop projecting belief and wait for clear absolute evidence. I have never seen that trait in you so far.
It is possible to learn all that mankind has to offer and not believe any of it, until it is absolutely proven to you.
It does not matter if the whole world believes in some idea, if you have no absolute evidence of it, it is just "junk" to ponder but never form any solid opinion or belief on it.
If you don't know; you don't know. Admit it! and be free of this fairy tale.
I know for a fact that you nor anyone on the face of this earth knows how this "different" happens in offspring.
It is only because of infused (children are pressured into belief, like a social pressure cooker!) belief that you would think this was a random mutation and that is not evidence of anything.
There are no transitional creatures in the fossil record.
And you say all creatures are transitional.
Where is my sixth finger that is supposed to be developing?
Where is my better forearm bones that should be developing?
How come I can't see any transitional features in my children or in myself. There is no partial second thingy erectus that I should have. I could use it.
You see how ridiculous your belief seems to me.
In the last 125 million years of fossil and specimen history in the fossil record (by the screwed up dating methods) there is not a single fossil with any partial development of any new feature, nor any slight indication of partial changes. Did you know that? All that appears is complete creatures, distinct and not transitional.
There is one bone in a fish that looks like it might be, but it has no objective answer in it, because there is no transitional fossils to or from it in time.
You must know what fossil I am talking about.
How can anyone believe this crap? How did anyone let themselves go so deep without thinking of the obvious and what is real?
None of what I teach is allowed to be taught in school, because it would ruin the indoctrination of this religion.
I think all religious beliefs need to be kept from all public schools. If you want to teach this crap religion, teach it in your Evodelusion private religion schools like other religions do.
"The only thing that interferes with my learning is my education." Albert Einstein
Do you think he was kidding? Do you think humans have changed their stupid nature to some how need to believe in fantasy having become more "modern" now, and that does not apply? Crap they are dumber than ever.
"Just because some messed up authority, that you think might be real, teaches you to believe in crap, has never been evidence of reality contained in the classroom." GoodScienceForYou
"Seek your own truth. When you have absolute evidence of anything then you can say it is true."
"Opinions are never to be considered to be absolutely true."
I wish you the best, really!