Welcome, Guest. Please Login
YaBB - Yet another Bulletin Board
  We've upgraded to YaBB 2!
  HomeHelpSearchLogin  
 
Pages: 1 2 3 4 5 
Send Topic Print
It's important to start simple. (Read 20663 times)
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #30 - Nov 19th, 2009 at 8:57pm
 
Go back and read it all over again and again, until is sinks in.

Evolution is not science.  It is nonsense. It has no empirical absolute evidence.  It only has belief and projection of belief on "evidence".

I have empathy for  people who are indoctrinated into this nonsense that has no evidence, and are so brainwashed and indoctrinated.  It is really sad to see this crap pseudo science in my precious science. It degrades real and functional science.  It has added nothing to biology and has messed up medical science with confusion and bad prescription drugs.

That is why I am going to get it out of science.  It is a mythological religion, and it is extremely obvious to me. It retards any real science advancement in biology.  You cannot force belief on evidence and have good results.

If you want to get free of this delusion, I can help you, but you must take on the role of student, because so far all you have shown me is that your belief is strong, but has no basis.  This is obvious to me.

Eventually I plan on suing to get this crap out of schools.  No religion of any kind should be taught in classrooms and this qualifies as mythology.

If you have any evidence that is absolute, clear, irrefutable and has no opinions in it, then where is it? No gray evidence that has other possibilities allowed.    Why would you believe in something that is based on belief and opinions from believers, because there is one thing for sure: You do not have any evidence that would give rise to any belief in this as even close to being a science.  It is no more science than Scientology.

All I see on the field of arguments is vague inferences and trying to tie things together that are not part of any science.

Listen to these two videos and wake up! I am all for you breaking free of this nonsense and becoming a real neutral, and objective scientist, because your belief destroys your credibility and makes you not capable of teaching this to someone who has no beliefs in anything with no evidence. All beliefs in things that are not proved is bad for you. Retards your development as a human and as a scientist.

I advise all people to watch all of my videos.  If you are not completely brainwashed you may actually get free of one delusional belief.

I really wish all the best that life has to offer you. I really do. Smiley Smiley












Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
Start Simple
Ex Member


Re: It's important to start simple.
Reply #31 - Nov 20th, 2009 at 9:54am
 
Do you have a similar website about the evil and entrenched dogma of round earth theory?  Shocked

The more you type the more you reveal just how little you know about biology. I don't want into the auto shop and give the mechanics lectures about carburetors.. why? Because I don't know garbage about them! What makes you think you can challenge science without foundational knowledge.

I tried to work this slowly with you but you refused. Apparently you don't have time for facts. You must preach at your own pace and get the good word out to all of the brainwashed masses. This is truly insane.

Eviscerating the same invalid arguments over and over has been entertaining, and all of the Einstein quotes have been illuminating, but is this really all you have? You went through the trouble of putting together a website and videos and all of the HEMG nonsense and all you have is "a horse always gives birth to a horse".

I hope you're at least enjoying yourself. That's about as productive as this could ever possibly be.
Back to top
 
 
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #32 - Nov 20th, 2009 at 12:44pm
 
Quote:
Do you have a similar website about the evil and entrenched dogma of round earth theory?  Shocked

The more you type the more you reveal just how little you know about biology. I don't want into the auto shop and give the mechanics lectures about carburetors.. why? Because I don't know garbage about them! What makes you think you can challenge science without foundational knowledge.

I tried to work this slowly with you but you refused. Apparently you don't have time for facts. You must preach at your own pace and get the good word out to all of the brainwashed masses. This is truly insane.

Eviscerating the same invalid arguments over and over has been entertaining, and all of the Einstein quotes have been illuminating, but is this really all you have? You went through the trouble of putting together a website and videos and all of the HEMG nonsense and all you have is "a horse always gives birth to a horse".

I hope you're at least enjoying yourself. That's about as productive as this could ever possibly be.



You are starting to sound paranoid.  I know more about biology than you do and this is obvious to anyone reading this who has any awareness of reality.

I am exactly who I tell you I am.  You go read about it.

I have no religious affiliation and I certainly have no religious affiliation with the bovine garbage of Evodelusionism (my term for your religion.)

If you want to grow some brains and actually understand anything about biology or any science you have to remove all conflicting bovine garbage from your brain.  You cannot be a scientist if you have any beliefs that have no absolute evidence.

If you want intellectual muscles, you need to get free from delusions.  This has actually been shown that when you get your brain clear of nonsense your IQ goes up.

One should never seek to perpetuate beliefs that are not founded on absolute evidence. If you don't know what absolute evidence is, I  can teach you. Smiley



Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
Start Simple
Ex Member


Re: It's important to start simple.
Reply #33 - Nov 20th, 2009 at 1:03pm
 
Quote:
I know more about biology than you do

Yeah. Your descriptions of genetics and mutation illustrate this perfectly.. LOL...  Grin

Quote:
Evodelusionism (my term for your religion.)

Oh here's a new word. I certainly haven't seen it in ANY posts you've made hear. Totally new. Wow, insightful..

Funny how you call this a "Neutral Evolution Forum" and then you already believe evolution is a delusion.
Back to top
 
 
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #34 - Nov 20th, 2009 at 5:03pm
 
I have given you full power to post anything you want. videos, photos, quotes from PhD's (I love to answer those).
It is totally an open neutral forum for you and all your friends if you have any.
It is open to all who can just argue the topic, without breaking any laws.  I give you privacy on your identity as well.  I don't care who you are or what you think you know.

So far you are not doing well on the evidence thing.

What exactly is the evidence that has NO opinions in it and no faith and belief in it that would cause a sane person (tested) as myself to want to believe you?  So,far you seem really not aware of anything you say.  You don't even see the tremendous logical fallacies you "parrot" from other believers who brainwashed you.  It is like your were fed drugs and kept in a dark room with flashing images of "Darwin" and various birds and such, until you became brainwashed.

How is it possible that you actually believe this crap, when you have not given any solid evidence that would even suggest evolution.  You have to have your intelligence tied in knots to allow this abuse of logic in your life.
Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #35 - Nov 22nd, 2009 at 12:07am
 
The "traits" of the offspring are contained in the DNA.
You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations.  There are changed to the DNA that reflect adjustments to the environment but those can be dropped as they are no longer needed.
Like the teeth in chickens could be needed if the environment changes.
Evolution is not even a consideration, because there is no physical evdence to conclude this. 
In the fossil record are only complete creatures that came into existence, remained the same, went extinct or are still here today as the same creatures with the same morphology, some after 125 million years.
There are no transitional creatures in the fossil record, unless you project belief on them.  Without belief they do not exist.
Get rid of the belief and be a free thinker. You will also become a whole lot more intelligent, when clear thoughts are all you have. 

What you do is to project your belief in evolution on all the evidence. That is a common human failing. And believing in human authority that has messed up agendas is part of your problem.

Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
FackCheck
Ex Member


Re: It's important to start simple.
Reply #36 - Nov 22nd, 2009 at 11:38am
 
Quote:
The "traits" of the offspring are contained in the DNA.
You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations.


Take a hypothetical gene.
In a parent, it looks like this:
atcgcaactctgaccagtactgcgacgtagtcatctgacggtacgtagcagctgagtcacag

And in a child, it might look like this
atcgcaactctgaccagtactgcgacgtagtcatcagacggtacgtagcagctgagtcacag

You see the change? That's a mutation. It's a pretty simple idea. These have been documented. It is a germ-line mutation.. so that strand of DNA existed in the parent for a short while, but the changed gene isn't in the parents genome. So it didn't "come from" the parent.

And I don't know what you think gene expression is, but it has nothing to do with heredity in this sense. It's about the promotion of genes within cells and the RNA / Protein products they produce.

Quote:
There are no transitional creatures in the fossil record

Every living thing is transitional.
Back to top
 
 
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #37 - Nov 22nd, 2009 at 4:53pm
 
Are we going to have a decent discussion on this?
I am sick of me doing nothing but stating the facts and Evodelusionist going berserk.  Can you remain on topic and can you actually read what I post. I give you the respect of reading all you post, you do the same. I don't want to ban anyone, I want an open discussion so we can all learn.

Quote:
Quote:
The "traits" of the offspring are contained in the DNA.
You have no clue where or what the cause of the appearance of "different" DNA comes from. As I stated the ONLY place where these DNA strands can be from is from the parents DNA mixing to produce the offspring.  It cannot come from any place else.  That would strongly show that this "changed" DNA is not changed at all but is an expression of DNA passed down the line from the entire lineage of the genealogy of the creature's ancestors.  It can not come from random mutations.


Take a hypothetical gene.
In a parent, it looks like this:
atcgcaactctgaccagtactgcgacgtagtcatctgacggtacgtagcagctgagtcacag

And in a child, it might look like this
atcgcaactctgaccagtactgcgacgtagtcatcagacggtacgtagcagctgagtcacag

You see the change? That's a mutation. It's a pretty simple idea. These have been documented. It is a germ-line mutation.. so that strand of DNA existed in the parent for a short while, but the changed gene isn't in the parents genome. So it didn't "come from" the parent.

And I don't know what you think gene expression is, but it has nothing to do with heredity in this sense. It's about the promotion of genes within cells and the RNA / Protein products they produce.

Quote:
There are no transitional creatures in the fossil record

Every living thing is transitional.


"A guess is never an absolute truth."

You do not have a clue how the difference in the DNA of the offspring was established (how it was caused). That I know for absolute sure, in any creature bacteria prokaryotes, Eukaryota or  human or dogs .  This is because you do not know the cause and with your belief you try to make it fit your belief.  You see the results and make up what you think it is from belief and very limited knowledge.


There can be no random in DNA.  If it was random there would be no life.  Noting can be different than the cause.

You would have to be a moron to believe in "random mutations". This violates the laws of physics.

Random means there is no genetic structure that supports life.  Yet alll we have in evidence is supported by the laws of genetic stability and the transference of traits and information to the DNA.  There are no magical, mystical events in real science.  There can only be structure and science.  The genome is the result of the genetic information that you can see. The cause you can't see. When you see something in the physical that appears it is only the result of a cause and is never random.

You are extremely stupid and you do what for a living.  People trust a dumb ass like you to perform genetic science and you don't understand the fundamentals of physics??

What the hell are they teaching you?  Do they tell you that it is OK to believe that you can violate the structure of the universe, and its laws? 

If you can get away and back off on this belief that has no evidence then you can come into reality. When you don't know for crying out loud, admit it!!  Wink

There is no such thing as random in natural science, only in religious mystical bovine garbage that you believe.

Anything you can see in this universe is the result of a cause, and not random. When you look at DNA you see a result. You have no idea the cause of this different DNA in the human genome.  If you say that DNA is causal it is because of your tiny weak little mind, projecting your messed up Evodelusion beliefs.

Here is what I think this different DNA is. It is an "expression" of traits that are below the level that you can see. There is no such thing as random in the physical world.  Even your

high priests that go around fighting creationists for the cause of Evodelusionism state this. If you think there is random you are not a scientist. There is only logic and reason not fantasy and belief.

The only place where any construct of DNA or any information contained in the offspring can come from is the parents.  There is no other way it can get there that any rational person would think or could think. 

There is no magical mystical random mutation that takes place by accident.  It follows logic that ancient DNA patterns can be evoked in the reproductive process.  That these patterns are from pre-existing patterns and genetic coding that is the root cause of the DNA replication process in the parents (or any creature).


You are just too stupid to understand this.

Because what I say is far more plausible than some random event, my hypothesis is far more rational, but is still just an extreme use of logic that has no beliefs in it. Beliefs destroy all credibility in a scientist as they are no longer objective when belief is first and foremost.

Scientists are supposed to follow the rules of science and not make up crap from delusional beliefs. What is real is right in front of your face, but you can't see it because of the human emotional mental garbage colored glasses you wear.

Jut like in the old days they had no idea that germs existed. Just like we had crude microscopes that could barely make out images of bacteria, and now we have the ability to see DNA constructs. Some day we will see even deeper and find the real cause of this apparent difference in the offspring.
Right now any belief projected on this is just ideas with NO evidence and only OPINIONS and that is all. It is crap pseudo science.

The results you see in the DNA are not the cause.  Get it?


When someone projects opinions on evidence and thinks it is real they are not sane.

That is why I never do it.  I will tell you it is an opinion and only an opinion, but my opinion(s) makes a hell of a lot more sense than yours. Yours is tautology, indoctrination and group belief.  Mine is from keeping clear of people's beliefs.
And keeping myself clear of beliefs until the evidence is HARD, has no opinions in it, obvious and absolutely clear and irrefutable. 

My pure logical statements refutes any possibility of your belief as any more plausible than the tooth fairy.


Do you understand that when there is any other more plausible answer, it negates the belief?  This is pure logic and reason with no belief. Most people are not capable of this level of objectivity I have found.

Projecting the idea of "random mutations" on something that is not random is you belief and projection of belief, based on nothing but belief, because there is no evidence to back it and it violates the laws of physics.
No scientist would ever violate the laws of physics. But for some reason you do. Could it be that you are brainwashed and ignorant of real science?

When something appears that you don't understand you force your belief on it, automatically.  This is human nature; because humans cannot stand to not understand something so they come up with crap that fits their preexisting belief. (and it sounds so logical to brainwashed believers):  Human nature is to fill in the blanks with belief and think it is real.

It is better to stop projecting belief and wait for clear absolute evidence. I have never seen that trait in you so far.

It is possible to learn all that mankind has to offer and not believe any of it, until it is absolutely proven to you.
It does not matter if the whole world believes in some idea, if you have no absolute evidence of it, it is just "junk" to ponder but never form any solid opinion or belief on it.

If you don't know; you don't know. Admit it! and be free of this fairy tale.

I know for a fact that you nor anyone on the face of this earth knows how this "different" happens in offspring.

It is only because of infused (children are pressured into belief, like a social pressure cooker!) belief that you would think this was a random mutation and that is not evidence of anything.


...

There are no transitional creatures in the fossil record.
And you say all creatures are transitional.

Where is my sixth finger that is supposed to be developing?
Where is my better forearm bones that should be developing?

How come I can't see any transitional features in my children or in myself.  There is no partial second thingy erectus that I should have. I could use it. 

You see how ridiculous your belief seems to me.

In the last 125 million years of fossil and specimen history in the fossil record (by the screwed up dating methods) there is not a single fossil with any partial development of any new feature, nor any slight indication of partial changes. Did you know that?  All that appears is complete creatures, distinct and not transitional. 

There is one bone in a fish that looks like it might be, but it has no objective answer in it, because there is no transitional fossils to or from it in time.

You must know what fossil I am talking about.
How can anyone believe this crap? How did anyone let themselves go so deep without thinking of the obvious and what is real?

None of what I teach is allowed to be taught in school, because it would ruin the indoctrination of this religion.
I think all religious beliefs need to be kept from all public schools.  If you want to teach this crap religion, teach it in your Evodelusion private religion schools like other religions do.

"The only thing that interferes with my learning is my education." Albert Einstein

Do you think he was kidding? Do you think humans have changed their stupid nature to some how need to believe in fantasy having become more "modern" now, and that does not apply? Crap they are dumber than ever.

"Just because some messed up authority, that you think might be real, teaches you to believe in crap, has never been evidence of reality contained in the classroom." GoodScienceForYou

"Seek your own truth. When you have absolute evidence of anything then you can say it is true." 

"Opinions are never to be considered to be absolutely true."

I wish you the best, really! Smiley
Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #38 - Nov 23rd, 2009 at 6:35pm
 
"collection of mutually shared axioms."

Axioms are not evidence, they are part of the indoctrination process that you think is science.

Why would you fall for that idea?

Unless you have absolute evidence nothing is real. Smiley

Re-read the long post. I fixed the spelllling errrors.

Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
ex_chump
Ex Member


Re: It's important to start simple.
Reply #39 - Nov 23rd, 2009 at 6:52pm
 
Quote:
Where is my sixth finger that is supposed to be developing?
Where is my better forearm bones that should be developing?


I don't understand these questions. Could you elaborate?
Back to top
 
 
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #40 - Nov 23rd, 2009 at 7:48pm
 
Quote:
Quote:
Where is my sixth finger that is supposed to be developing?
Where is my better forearm bones that should be developing?


I don't understand these questions. Could you elaborate?


If you follow the "logic" of evodelusionism, we have very strong "evolutionary pressure" to develop more fingers. If hands are used for so many things and required for survival, then they would be showing signs of new appendages growing as we "transition" towards more evolution. 

This idea of transitional means transitional features have to show in the body.  There are none of these in any creature or any fossil.  I determined this long long ago as a prerequisite for any form of belief in this pseudo (unproven to even be science) science.


Now scientists, who are "rabid" Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?   Grin
Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
ex_chump
Ex Member


Re: It's important to start simple.
Reply #41 - Nov 23rd, 2009 at 7:54pm
 
Quote:
Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?


Does the strength of ones forearm often have implications on a persons chances to produce young?
Back to top
 
 
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #42 - Nov 23rd, 2009 at 10:29pm
 
Quote:
Quote:
Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?


Does the strength of ones forearm often have implications on a persons chances to produce young?

Watch this delusional weak human's:  Human emotional mental garbage in this  moron's video.
This is some of the crap for brain idiots spawned by brainwashing.  These guys need to get a room, that is what is obvious in this video. This Dr is in love.




Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
GoodScienceForYou
YaBB Administrator
*****
Offline


The obvious isn't obvious
until it is obvious

Posts: 1361
United States
Gender: male
Re: It's important to start simple.
Reply #43 - Nov 23rd, 2009 at 10:40pm
 
Quote:
Quote:
Evodelusionists tell me that my forearm is a terrible design that it gets broken all the time because it is weak.  Why is it not stronger?  Why is it not showing any signs of becoming stronger in the evolution of mankind?


Does the strength of ones forearm often have implications on a persons chances to produce young?


Do you know that there is no evidence for evolution theory?
How can you not know this?  It is only based upon ideas and beliefs. There is no actual physical evidence showing any possibility of evolution of any life on earth?
Back to top
 

"Putting your faith in humanity has historically not been a good concept. Why do you think it is "different" now?"
"Find the truth for yourself and don't succumb to indoctrination."
WWW  
IP Logged
 
ex_chump
Ex Member


Re: It's important to start simple.
Reply #44 - Nov 24th, 2009 at 6:31am
 
Way to "side step" the question.

You're a hypocrite.

Direct question: Does the strength of ones forearm have any bearing on ones ability to procreate?

Selective pressure works that way. You don't know that. So how can you possibly argue against something you don't even understand.
Back to top
 
 
IP Logged
 
Pages: 1 2 3 4 5 
Send Topic Print